EMAIL THIS PAGE TO A FRIEND

DENND4C

DENN/MADD domain containing 4C

Synonyms: C9orf55 C9orf55B bA513M16.3
Gene ID:
Mouse(329877) DENN/MADD domain containing 4C
Zebrafish(558626) DENN/MADD domain containing 4C
chicken(427236) DENN/MADD domain containing 4C
cow(536760) DENN/MADD domain containing 4C
Horse(100052312) DENN/MADD domain containing 4C
domestic cat(101098094) DENN/MADD domain containing 4C
dog(474721) DENN/MADD domain containing 4C
domestic guinea pig(100730746) DENN/MADD domain containing 4C
naked mole-rat(101722486) DENN/MADD domain containing 4C
sheep(101123605) DENN/MADD domain containing 4C
Domestic Rabbit(100338617) DENN/MADD domain containing 4C
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017925 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017925 Rosetta Predictions human pricing
NM_001081014 Rosetta Predictions mouse pricing
XM_001001506 Rosetta Predictions mouse pricing
XM_283972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350925 predicted 2186
2 SASI_Hs01_00032004 predicted 4516
3 SASI_Hs01_00032005 predicted 773
4 SASI_Hs01_00032008 predicted 477
5 SASI_Hs02_00350926 predicted 2916
6 SASI_Hs01_00032009 predicted 4262
7 SASI_Hs01_00032010 predicted 2793
8 SASI_Hs01_00032011 predicted 2027
9 SASI_Hs01_00032013 predicted 3439
10 SASI_Hs02_00350927 predicted 920
11 SASI_Hs01_00032006 predicted 4634
12 SASI_Hs01_00032007 predicted 3059
13 SASI_Hs01_00032012 predicted 4810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294386 predicted 2149
2 SASI_Mm02_00294387 predicted 2945
3 SASI_Mm02_00294388 predicted 1819
4 SASI_Mm02_00294389 predicted 1241
5 SASI_Mm02_00294390 predicted 2425
6 SASI_Mm02_00294391 predicted 1992
7 SASI_Mm02_00294392 predicted 3365
8 SASI_Mm02_00294393 predicted 989
9 SASI_Mm02_00294394 predicted 2666
10 SASI_Mm02_00294395 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282632 predicted 2953
2 SASI_Mm01_00282633 predicted 1834
3 SASI_Mm01_00282634 predicted 1254
4 SASI_Mm01_00282635 predicted 1999
5 SASI_Mm01_00282636 predicted 3365
6 SASI_Mm01_00282637 predicted 988
7 SASI_Mm01_00282638 predicted 1227
8 SASI_Mm01_00282639 predicted 3983
9 SASI_Mm01_00282640 predicted 3149
10 SASI_Mm01_00282641 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284359 predicted 2947
2 SASI_Mm01_00284360 predicted 1830
3 SASI_Mm01_00284361 predicted 1246
4 SASI_Mm01_00284362 predicted 1998
5 SASI_Mm01_00284363 predicted 6112
6 SASI_Mm01_00284364 predicted 3369
7 SASI_Mm01_00284365 predicted 993
8 SASI_Mm01_00284366 predicted 1227
9 SASI_Mm01_00284367 predicted 3987
10 SASI_Mm01_00284368 predicted 1530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081014
VALIDATED
DENND4C MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 4C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081014.1-5259s21c1
Sequence:CCGGGGAGTAGATTCTTGCAATTAACTCGAGTTAATTGCAAGAATCTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081014.1-4714s21c1
Sequence:CCGGGGCCTAGAAGACCATCATATACTCGAGTATATGATGGTCTTCTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081014.1-2935s21c1
Sequence:CCGGGCTATCACTTATGGCTATTACCTCGAGGTAATAGCCATAAGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081014.1-2071s21c1
Sequence:CCGGTTGCGATTTATGGCGTCTATTCTCGAGAATAGACGCCATAAATCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081014.1-1698s21c1
Sequence:CCGGTCAGTGGCAGTGCCCATATATCTCGAGATATATGGGCACTGCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081014
VALIDATED
DENND4C MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 4C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081014.1-5259s21c1
Sequence:CCGGGGAGTAGATTCTTGCAATTAACTCGAGTTAATTGCAAGAATCTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081014.1-4714s21c1
Sequence:CCGGGGCCTAGAAGACCATCATATACTCGAGTATATGATGGTCTTCTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081014.1-2935s21c1
Sequence:CCGGGCTATCACTTATGGCTATTACCTCGAGGTAATAGCCATAAGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081014.1-2071s21c1
Sequence:CCGGTTGCGATTTATGGCGTCTATTCTCGAGAATAGACGCCATAAATCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081014.1-1698s21c1
Sequence:CCGGTCAGTGGCAGTGCCCATATATCTCGAGATATATGGGCACTGCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081014
VALIDATED
DENND4C MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 4C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081014.1-5259s21c1
Sequence:CCGGGGAGTAGATTCTTGCAATTAACTCGAGTTAATTGCAAGAATCTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081014.1-4714s21c1
Sequence:CCGGGGCCTAGAAGACCATCATATACTCGAGTATATGATGGTCTTCTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081014.1-2935s21c1
Sequence:CCGGGCTATCACTTATGGCTATTACCTCGAGGTAATAGCCATAAGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081014.1-2071s21c1
Sequence:CCGGTTGCGATTTATGGCGTCTATTCTCGAGAATAGACGCCATAAATCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081014.1-1698s21c1
Sequence:CCGGTCAGTGGCAGTGCCCATATATCTCGAGATATATGGGCACTGCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017925
VALIDATED
DENND4C MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 4C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017925.3-4151s1c1
Sequence:CCGGCCTAGTAACTTGCCAGGACTTCTCGAGAAGTCCTGGCAAGTTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017925.3-3016s1c1
Sequence:CCGGGCCCAAGATAGATGTCCTGAACTCGAGTTCAGGACATCTATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017925.3-1988s1c1
Sequence:CCGGCCAGTTGAAGATGCAGTCTTTCTCGAGAAAGACTGCATCTTCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017925.3-4835s1c1
Sequence:CCGGCCTTGAAATATGAAGTGCCATCTCGAGATGGCACTTCATATTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017925.3-3924s1c1
Sequence:CCGGCAACAGTTAGTCTTCCAAATACTCGAGTATTTGGAAGACTAACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017925.3-4865s1c1
Sequence:CCGGCCAGGGCTTATTAATATTGAACTCGAGTTCAATATTAATAAGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160762    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017925.3-4688s1c1
Sequence:CCGGCACTAGAATGTTGACACACAACTCGAGTTGTGTGTCAACATTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017925.3-4396s1c1
Sequence:CCGGGCAGAGTATTCAGCACAATAACTCGAGTTATTGTGCTGAATACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017925
VALIDATED
DENND4C MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 4C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017925.3-4151s1c1
Sequence:CCGGCCTAGTAACTTGCCAGGACTTCTCGAGAAGTCCTGGCAAGTTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017925.3-3016s1c1
Sequence:CCGGGCCCAAGATAGATGTCCTGAACTCGAGTTCAGGACATCTATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017925.3-1988s1c1
Sequence:CCGGCCAGTTGAAGATGCAGTCTTTCTCGAGAAAGACTGCATCTTCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017925.3-4835s1c1
Sequence:CCGGCCTTGAAATATGAAGTGCCATCTCGAGATGGCACTTCATATTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017925.3-3924s1c1
Sequence:CCGGCAACAGTTAGTCTTCCAAATACTCGAGTATTTGGAAGACTAACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017925.3-4865s1c1
Sequence:CCGGCCAGGGCTTATTAATATTGAACTCGAGTTCAATATTAATAAGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160762    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017925.3-4688s1c1
Sequence:CCGGCACTAGAATGTTGACACACAACTCGAGTTGTGTGTCAACATTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017925.3-4396s1c1
Sequence:CCGGGCAGAGTATTCAGCACAATAACTCGAGTTATTGTGCTGAATACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017925
VALIDATED
DENND4C MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 4C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017925.3-4151s1c1
Sequence:CCGGCCTAGTAACTTGCCAGGACTTCTCGAGAAGTCCTGGCAAGTTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017925.3-3016s1c1
Sequence:CCGGGCCCAAGATAGATGTCCTGAACTCGAGTTCAGGACATCTATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017925.3-1988s1c1
Sequence:CCGGCCAGTTGAAGATGCAGTCTTTCTCGAGAAAGACTGCATCTTCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017925.3-4835s1c1
Sequence:CCGGCCTTGAAATATGAAGTGCCATCTCGAGATGGCACTTCATATTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017925.3-3924s1c1
Sequence:CCGGCAACAGTTAGTCTTCCAAATACTCGAGTATTTGGAAGACTAACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017925.3-4865s1c1
Sequence:CCGGCCAGGGCTTATTAATATTGAACTCGAGTTCAATATTAATAAGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160762    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017925.3-4688s1c1
Sequence:CCGGCACTAGAATGTTGACACACAACTCGAGTTGTGTGTCAACATTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017925.3-4396s1c1
Sequence:CCGGGCAGAGTATTCAGCACAATAACTCGAGTTATTGTGCTGAATACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks