EMAIL THIS PAGE TO A FRIEND

DENND5A

DENN/MADD domain containing 5A

101 Gene Product Result for
Synonyms: RAB6IP1
Gene ID:
Mouse(19347) DENN/MADD domain containing 5A
Rat(308942) DENN/MADD domain containing 5A
sheep(101123580) DENN/MADD domain containing 5A
naked mole-rat(101703378) DENN/MADD domain containing 5A
domestic guinea pig(100729590) DENN/MADD domain containing 5A
Zebrafish(799847) DENN/MADD domain containing 5A
chicken(423048) DENN/MADD domain containing 5A
cow(784484) DENN/MADD domain containing 5A
Horse(100071112) DENN/MADD domain containing 5A
domestic cat(101085659) DENN/MADD domain containing 5A
dog(476844) DENN/MADD domain containing 5A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021494 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021494 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021494 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015213 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015213 Rosetta Predictions human pricing
NM_001107546 Rosetta Predictions rat pricing
XM_219270 Rosetta Predictions rat pricing
NM_021494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063353 predicted 484
2 SASI_Hs01_00063354 predicted 2363
3 SASI_Hs01_00063355 predicted 497
4 SASI_Hs02_00347321 predicted 3836
5 SASI_Hs01_00063356 predicted 3101
6 SASI_Hs01_00063357 predicted 3086
7 SASI_Hs01_00063359 predicted 728
8 SASI_Hs01_00063361 predicted 2065
9 SASI_Hs01_00063362 predicted 4088
10 SASI_Hs02_00347322 predicted 4010
11 SASI_Hs01_00063358 predicted 1232
12 SASI_Hs01_00063360 predicted 4193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229895 predicted 222
2 SASI_Rn02_00229896 predicted 228
3 SASI_Rn02_00229897 predicted 226
4 SASI_Rn02_00229898 predicted 236
5 SASI_Rn02_00229899 predicted 196
6 SASI_Rn02_00229900 predicted 213
7 SASI_Rn02_00229901 predicted 217
8 SASI_Rn02_00229902 predicted 218
9 SASI_Rn02_00229903 predicted 220
10 SASI_Rn02_00229904 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181857 predicted 1129
2 SASI_Rn01_00181858 predicted 3842
3 SASI_Rn01_00181859 predicted 3788
4 SASI_Rn01_00181860 predicted 717
5 SASI_Rn01_00181861 predicted 1704
6 SASI_Rn01_00181862 predicted 3770
7 SASI_Rn01_00181863 predicted 1999
8 SASI_Rn01_00181864 predicted 3087
9 SASI_Rn01_00181865 predicted 966
10 SASI_Rn01_00181866 predicted 2071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055473 predicted 1125
2 SASI_Mm01_00055474 predicted 1787
3 SASI_Mm02_00326197 predicted 856
4 SASI_Mm01_00055477 predicted 3279
5 SASI_Mm01_00055478 predicted 1823
6 SASI_Mm02_00326198 predicted 1447
7 SASI_Mm01_00055479 predicted 3080
8 SASI_Mm02_00326199 predicted 626
9 SASI_Mm01_00055480 predicted 2065
10 SASI_Mm01_00055481 predicted 454
11 SASI_Mm01_00055475 predicted 3270
12 SASI_Mm01_00055476 predicted 1571
13 SASI_Mm01_00055482 predicted 3826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021494
VALIDATED
DENND5A MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 5A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021494.1-4717s1c1
Sequence:CCGGGCACAAAGTTGCACAGGAGTACTCGAGTACTCCTGTGCAACTTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021494.1-356s1c1
Sequence:CCGGGCCAGTACATTCAGGCTTCTACTCGAGTAGAAGCCTGAATGTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021494.1-3282s1c1
Sequence:CCGGCCATGATAATTCTGGGCTGTACTCGAGTACAGCCCAGAATTATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021494.1-1093s1c1
Sequence:CCGGCCCGTCAAAGAGGTCTTTGAACTCGAGTTCAAAGACCTCTTTGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021494.1-1758s1c1
Sequence:CCGGGCTCAGGATTTACCAGCTAAACTCGAGTTTAGCTGGTAAATCCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021494
VALIDATED
DENND5A MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 5A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021494.1-4717s1c1
Sequence:CCGGGCACAAAGTTGCACAGGAGTACTCGAGTACTCCTGTGCAACTTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021494.1-356s1c1
Sequence:CCGGGCCAGTACATTCAGGCTTCTACTCGAGTAGAAGCCTGAATGTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021494.1-3282s1c1
Sequence:CCGGCCATGATAATTCTGGGCTGTACTCGAGTACAGCCCAGAATTATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021494.1-1093s1c1
Sequence:CCGGCCCGTCAAAGAGGTCTTTGAACTCGAGTTCAAAGACCTCTTTGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021494.1-1758s1c1
Sequence:CCGGGCTCAGGATTTACCAGCTAAACTCGAGTTTAGCTGGTAAATCCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021494
VALIDATED
DENND5A MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 5A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021494.1-4717s1c1
Sequence:CCGGGCACAAAGTTGCACAGGAGTACTCGAGTACTCCTGTGCAACTTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021494.1-356s1c1
Sequence:CCGGGCCAGTACATTCAGGCTTCTACTCGAGTAGAAGCCTGAATGTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021494.1-3282s1c1
Sequence:CCGGCCATGATAATTCTGGGCTGTACTCGAGTACAGCCCAGAATTATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021494.1-1093s1c1
Sequence:CCGGCCCGTCAAAGAGGTCTTTGAACTCGAGTTCAAAGACCTCTTTGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021494.1-1758s1c1
Sequence:CCGGGCTCAGGATTTACCAGCTAAACTCGAGTTTAGCTGGTAAATCCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015213
VALIDATED
DENND5A MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 5A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_015213.2-4727s1c1
Sequence:CCGGGCACAGTTTCACAGAAGTAAACTCGAGTTTACTTCTGTGAAACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_015213.2-3118s1c1
Sequence:CCGGCCGTACCACATTCTGATCGTACTCGAGTACGATCAGAATGTGGTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_015213.2-1188s1c1
Sequence:CCGGCCTGCTCTACTCACAGCATTACTCGAGTAATGCTGTGAGTAGAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_015213.2-822s1c1
Sequence:CCGGGCGCTTCAACTCCTATGACATCTCGAGATGTCATAGGAGTTGAAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015213.2-4727s21c1
Sequence:CCGGGCACAGTTTCACAGAAGTAAACTCGAGTTTACTTCTGTGAAACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015213.2-1188s21c1
Sequence:CCGGCCTGCTCTACTCACAGCATTACTCGAGTAATGCTGTGAGTAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015213.2-3118s21c1
Sequence:CCGGCCGTACCACATTCTGATCGTACTCGAGTACGATCAGAATGTGGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015213.2-822s21c1
Sequence:CCGGGCGCTTCAACTCCTATGACATCTCGAGATGTCATAGGAGTTGAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015213
VALIDATED
DENND5A MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 5A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_015213.2-4727s1c1
Sequence:CCGGGCACAGTTTCACAGAAGTAAACTCGAGTTTACTTCTGTGAAACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_015213.2-3118s1c1
Sequence:CCGGCCGTACCACATTCTGATCGTACTCGAGTACGATCAGAATGTGGTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_015213.2-1188s1c1
Sequence:CCGGCCTGCTCTACTCACAGCATTACTCGAGTAATGCTGTGAGTAGAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_015213.2-822s1c1
Sequence:CCGGGCGCTTCAACTCCTATGACATCTCGAGATGTCATAGGAGTTGAAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015213.2-4727s21c1
Sequence:CCGGGCACAGTTTCACAGAAGTAAACTCGAGTTTACTTCTGTGAAACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015213.2-1188s21c1
Sequence:CCGGCCTGCTCTACTCACAGCATTACTCGAGTAATGCTGTGAGTAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015213.2-3118s21c1
Sequence:CCGGCCGTACCACATTCTGATCGTACTCGAGTACGATCAGAATGTGGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015213.2-822s21c1
Sequence:CCGGGCGCTTCAACTCCTATGACATCTCGAGATGTCATAGGAGTTGAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015213
VALIDATED
DENND5A MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 5A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_015213.2-4727s1c1
Sequence:CCGGGCACAGTTTCACAGAAGTAAACTCGAGTTTACTTCTGTGAAACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_015213.2-3118s1c1
Sequence:CCGGCCGTACCACATTCTGATCGTACTCGAGTACGATCAGAATGTGGTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_015213.2-1188s1c1
Sequence:CCGGCCTGCTCTACTCACAGCATTACTCGAGTAATGCTGTGAGTAGAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_015213.2-822s1c1
Sequence:CCGGGCGCTTCAACTCCTATGACATCTCGAGATGTCATAGGAGTTGAAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015213.2-4727s21c1
Sequence:CCGGGCACAGTTTCACAGAAGTAAACTCGAGTTTACTTCTGTGAAACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015213.2-1188s21c1
Sequence:CCGGCCTGCTCTACTCACAGCATTACTCGAGTAATGCTGTGAGTAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015213.2-3118s21c1
Sequence:CCGGCCGTACCACATTCTGATCGTACTCGAGTACGATCAGAATGTGGTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015213.2-822s21c1
Sequence:CCGGGCGCTTCAACTCCTATGACATCTCGAGATGTCATAGGAGTTGAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)