EMAIL THIS PAGE TO A FRIEND

DENND5B

DENN/MADD domain containing 5B

Gene ID:
Mouse(320560) DENN/MADD domain containing 5B
Rat(100365679) DENN/MADD domain containing 5B
Zebrafish(323528) DENN/MADD domain containing 5B
dog(477651) DENN/MADD domain containing 5B
cow(516544) DENN/MADD domain containing 5B
Horse(100069859) DENN/MADD domain containing 5B
domestic cat(101089115) DENN/MADD domain containing 5B
chicken(418139) DENN/MADD domain containing 5B
domestic guinea pig(100713082) DENN/MADD domain containing 5B
naked mole-rat(101723499) DENN/MADD domain containing 5B
sheep(101109436) DENN/MADD domain containing 5B
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144973 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177192 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177192 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177192 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060451 MISSION® esiRNA esiRNA human DENND5B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144973 Rosetta Predictions human pricing
NM_177192 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202307 predicted 3673
2 SASI_Hs02_00364764 predicted 1945
3 SASI_Hs01_00202308 predicted 3441
4 SASI_Hs01_00202309 predicted 3168
5 SASI_Hs01_00202310 predicted 3741
6 SASI_Hs01_00202311 predicted 1967
7 SASI_Hs01_00202312 predicted 4064
8 SASI_Hs01_00202314 predicted 1415
9 SASI_Hs01_00202315 predicted 607
10 SASI_Hs02_00364765 predicted 3183
11 SASI_Hs01_00202313 predicted 2588
12 SASI_Hs01_00202316 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086371 predicted 770
2 SASI_Mm01_00086373 predicted 2460
3 SASI_Mm01_00086374 predicted 2731
4 SASI_Mm01_00086375 predicted 2307
5 SASI_Mm02_00347195 predicted 3352
6 SASI_Mm02_00347196 predicted 3563
7 SASI_Mm02_00347197 predicted 3502
8 SASI_Mm02_00347198 predicted 3172
9 SASI_Mm01_00086379 predicted 2145
10 SASI_Mm01_00086380 predicted 1459
11 SASI_Mm01_00086372 predicted 1279
12 SASI_Mm01_00086376 predicted 594
13 SASI_Mm01_00086377 predicted 2740
14 SASI_Mm01_00086378 predicted 914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144973
VALIDATED
DENND5B MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 5B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144973.3-1955s21c1
Sequence:CCGGACACTCGGATTGATAAGATAACTCGAGTTATCTTATCAATCCGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144973.3-1487s21c1
Sequence:CCGGACGGCAATGTCTGTACTAATACTCGAGTATTAGTACAGACATTGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144973.3-2981s21c1
Sequence:CCGGCCACTATCATGATTCCGTATACTCGAGTATACGGAATCATGATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144973.3-2388s21c1
Sequence:CCGGATTCGTAGAAGGCTTATTAAACTCGAGTTTAATAAGCCTTCTACGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_144973.2-4584s1c1
Sequence:CCGGGCTCTGAGAAATGTGTTCAATCTCGAGATTGAACACATTTCTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144973.2-708s1c1
Sequence:CCGGGCGATACAACTCCTATGATATCTCGAGATATCATAGGAGTTGTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144973.2-4820s1c1
Sequence:CCGGCCTGTCTTTGTTAGGGTCTAACTCGAGTTAGACCCTAACAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144973.2-6314s1c1
Sequence:CCGGCCACCTATACAAGTAGGAAATCTCGAGATTTCCTACTTGTATAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144973.2-366s1c1
Sequence:CCGGCGCCCACTATCCTCAGAATATCTCGAGATATTCTGAGGATAGTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144973
VALIDATED
DENND5B MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 5B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144973.3-1955s21c1
Sequence:CCGGACACTCGGATTGATAAGATAACTCGAGTTATCTTATCAATCCGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144973.3-1487s21c1
Sequence:CCGGACGGCAATGTCTGTACTAATACTCGAGTATTAGTACAGACATTGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144973.3-2981s21c1
Sequence:CCGGCCACTATCATGATTCCGTATACTCGAGTATACGGAATCATGATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144973.3-2388s21c1
Sequence:CCGGATTCGTAGAAGGCTTATTAAACTCGAGTTTAATAAGCCTTCTACGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_144973.2-4584s1c1
Sequence:CCGGGCTCTGAGAAATGTGTTCAATCTCGAGATTGAACACATTTCTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144973.2-708s1c1
Sequence:CCGGGCGATACAACTCCTATGATATCTCGAGATATCATAGGAGTTGTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144973.2-4820s1c1
Sequence:CCGGCCTGTCTTTGTTAGGGTCTAACTCGAGTTAGACCCTAACAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144973.2-6314s1c1
Sequence:CCGGCCACCTATACAAGTAGGAAATCTCGAGATTTCCTACTTGTATAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144973.2-366s1c1
Sequence:CCGGCGCCCACTATCCTCAGAATATCTCGAGATATTCTGAGGATAGTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144973
VALIDATED
DENND5B MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 5B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144973.3-1955s21c1
Sequence:CCGGACACTCGGATTGATAAGATAACTCGAGTTATCTTATCAATCCGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144973.3-1487s21c1
Sequence:CCGGACGGCAATGTCTGTACTAATACTCGAGTATTAGTACAGACATTGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144973.3-2981s21c1
Sequence:CCGGCCACTATCATGATTCCGTATACTCGAGTATACGGAATCATGATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144973.3-2388s21c1
Sequence:CCGGATTCGTAGAAGGCTTATTAAACTCGAGTTTAATAAGCCTTCTACGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_144973.2-4584s1c1
Sequence:CCGGGCTCTGAGAAATGTGTTCAATCTCGAGATTGAACACATTTCTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144973.2-708s1c1
Sequence:CCGGGCGATACAACTCCTATGATATCTCGAGATATCATAGGAGTTGTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144973.2-4820s1c1
Sequence:CCGGCCTGTCTTTGTTAGGGTCTAACTCGAGTTAGACCCTAACAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144973.2-6314s1c1
Sequence:CCGGCCACCTATACAAGTAGGAAATCTCGAGATTTCCTACTTGTATAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144973.2-366s1c1
Sequence:CCGGCGCCCACTATCCTCAGAATATCTCGAGATATTCTGAGGATAGTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177192
VALIDATED
DENND5B MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 5B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177192.2-1988s1c1
Sequence:CCGGCGGGTCTTTGATTCTCGGATTCTCGAGAATCCGAGAATCAAAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177192.2-2047s1c1
Sequence:CCGGGCGGACATCTATATATCAGAACTCGAGTTCTGATATATAGATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177192.2-751s1c1
Sequence:CCGGGCGATACAACTCTTATGACATCTCGAGATGTCATAAGAGTTGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177192.2-1336s1c1
Sequence:CCGGCGTGGATATTGACAACCATTTCTCGAGAAATGGTTGTCAATATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177192.2-2048s1c1
Sequence:CCGGCGGACATCTATATATCAGAAACTCGAGTTTCTGATATATAGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177192
VALIDATED
DENND5B MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 5B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177192.2-1988s1c1
Sequence:CCGGCGGGTCTTTGATTCTCGGATTCTCGAGAATCCGAGAATCAAAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177192.2-2047s1c1
Sequence:CCGGGCGGACATCTATATATCAGAACTCGAGTTCTGATATATAGATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177192.2-751s1c1
Sequence:CCGGGCGATACAACTCTTATGACATCTCGAGATGTCATAAGAGTTGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177192.2-1336s1c1
Sequence:CCGGCGTGGATATTGACAACCATTTCTCGAGAAATGGTTGTCAATATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177192.2-2048s1c1
Sequence:CCGGCGGACATCTATATATCAGAAACTCGAGTTTCTGATATATAGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177192
VALIDATED
DENND5B MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 5B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177192.2-1988s1c1
Sequence:CCGGCGGGTCTTTGATTCTCGGATTCTCGAGAATCCGAGAATCAAAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177192.2-2047s1c1
Sequence:CCGGGCGGACATCTATATATCAGAACTCGAGTTCTGATATATAGATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177192.2-751s1c1
Sequence:CCGGGCGATACAACTCTTATGACATCTCGAGATGTCATAAGAGTTGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177192.2-1336s1c1
Sequence:CCGGCGTGGATATTGACAACCATTTCTCGAGAAATGGTTGTCAATATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177192.2-2048s1c1
Sequence:CCGGCGGACATCTATATATCAGAAACTCGAGTTTCTGATATATAGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks