EMAIL THIS PAGE TO A FRIEND

DENND6A

DENN/MADD domain containing 6A

173 Gene Product Result for
Synonyms: AFI1A FAM116A
UniProtKB ID: Q8IWF6, Q7Z5T4, Q8N235, Q8TEG8
Gene ID:
Mouse(211922) DENN/MADD domain containing 6A
Rat(306229) DENN/MADD domain containing 6A
chicken(416006) family with sequence similarity 116, member A
domestic cat(101081451) DENN/MADD domain containing 6A
sheep(101102518) DENN/MADD domain containing 6A
naked mole-rat(101711502) DENN/MADD domain containing 6A
domestic guinea pig(100723613) DENN/MADD domain containing 6A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152678 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145969 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145969 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145969 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152678 Rosetta Predictions human pricing
NM_001134467 Rosetta Predictions rat pricing
NM_145969 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161829 predicted 626
2 SASI_Hs01_00161830 predicted 1250
3 SASI_Hs01_00161831 predicted 1937
4 SASI_Hs01_00161832 predicted 1769
5 SASI_Hs01_00161833 predicted 1944
6 SASI_Hs02_00366571 predicted 340
7 SASI_Hs01_00161834 predicted 1042
8 SASI_Hs01_00161835 predicted 1805
9 SASI_Hs01_00161836 predicted 960
10 SASI_Hs01_00161837 predicted 1654
11 SASI_Hs01_00161838 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256399 predicted 608
2 SASI_Rn02_00256400 predicted 960
3 SASI_Rn02_00256401 predicted 944
4 SASI_Rn02_00256402 predicted 1235
5 SASI_Rn02_00256403 predicted 714
6 SASI_Rn02_00256404 predicted 768
7 SASI_Rn02_00256405 predicted 1010
8 SASI_Rn02_00256406 predicted 1206
9 SASI_Rn02_00256407 predicted 977
10 SASI_Rn02_00256408 predicted 1888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145969 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024752 predicted 631
2 SASI_Mm01_00024753 predicted 434
3 SASI_Mm01_00024754 predicted 1270
4 SASI_Mm01_00024755 predicted 738
5 SASI_Mm01_00024757 predicted 668
6 SASI_Mm01_00024758 predicted 978
7 SASI_Mm01_00024759 predicted 805
8 SASI_Mm01_00024760 predicted 1016
9 SASI_Mm02_00341456 predicted 1567
10 SASI_Mm02_00341457 predicted 341
11 SASI_Mm01_00024756 predicted 1784
12 SASI_Mm01_00024761 predicted 381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152678
DENND6A MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 6A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152678.1-2677s1c1
Sequence:CCGGCGCCTGTAATCCTAGCACTTTCTCGAGAAAGTGCTAGGATTACAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152678.1-1470s1c1
Sequence:CCGGCCACCTCAATTAAGACAGTTTCTCGAGAAACTGTCTTAATTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152678.1-285s1c1
Sequence:CCGGCAGGCCGTGGAGGTAATTTATCTCGAGATAAATTACCTCCACGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152678.1-1562s1c1
Sequence:CCGGGATTGGACTTTACCGGCATTTCTCGAGAAATGCCGGTAAAGTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152678.1-967s1c1
Sequence:CCGGCGGAATCATCAGAGACTGTATCTCGAGATACAGTCTCTGATGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152678.1-747s1c1
Sequence:CCGGGTGGTAATGAAGGTACGGATTCTCGAGAATCCGTACCTTCATTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152678.1-4234s1c1
Sequence:CCGGGCACAGCTAAACAGTAGCAAACTCGAGTTTGCTACTGTTTAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152678.2-1370s21c1
Sequence:CCGGTGTTATTCTTCGACGCTATTTCTCGAGAAATAGCGTCGAAGAATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152678.2-596s21c1
Sequence:CCGGGATCAGCAAACTACCTTATATCTCGAGATATAAGGTAGTTTGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152678
DENND6A MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 6A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152678.1-2677s1c1
Sequence:CCGGCGCCTGTAATCCTAGCACTTTCTCGAGAAAGTGCTAGGATTACAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152678.1-1470s1c1
Sequence:CCGGCCACCTCAATTAAGACAGTTTCTCGAGAAACTGTCTTAATTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152678.1-285s1c1
Sequence:CCGGCAGGCCGTGGAGGTAATTTATCTCGAGATAAATTACCTCCACGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152678.1-1562s1c1
Sequence:CCGGGATTGGACTTTACCGGCATTTCTCGAGAAATGCCGGTAAAGTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152678.1-967s1c1
Sequence:CCGGCGGAATCATCAGAGACTGTATCTCGAGATACAGTCTCTGATGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152678.1-747s1c1
Sequence:CCGGGTGGTAATGAAGGTACGGATTCTCGAGAATCCGTACCTTCATTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152678.1-4234s1c1
Sequence:CCGGGCACAGCTAAACAGTAGCAAACTCGAGTTTGCTACTGTTTAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152678.2-1370s21c1
Sequence:CCGGTGTTATTCTTCGACGCTATTTCTCGAGAAATAGCGTCGAAGAATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152678.2-596s21c1
Sequence:CCGGGATCAGCAAACTACCTTATATCTCGAGATATAAGGTAGTTTGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152678
DENND6A MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 6A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152678.1-2677s1c1
Sequence:CCGGCGCCTGTAATCCTAGCACTTTCTCGAGAAAGTGCTAGGATTACAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152678.1-1470s1c1
Sequence:CCGGCCACCTCAATTAAGACAGTTTCTCGAGAAACTGTCTTAATTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152678.1-285s1c1
Sequence:CCGGCAGGCCGTGGAGGTAATTTATCTCGAGATAAATTACCTCCACGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152678.1-1562s1c1
Sequence:CCGGGATTGGACTTTACCGGCATTTCTCGAGAAATGCCGGTAAAGTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152678.1-967s1c1
Sequence:CCGGCGGAATCATCAGAGACTGTATCTCGAGATACAGTCTCTGATGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152678.1-747s1c1
Sequence:CCGGGTGGTAATGAAGGTACGGATTCTCGAGAATCCGTACCTTCATTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152678.1-4234s1c1
Sequence:CCGGGCACAGCTAAACAGTAGCAAACTCGAGTTTGCTACTGTTTAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152678.2-1370s21c1
Sequence:CCGGTGTTATTCTTCGACGCTATTTCTCGAGAAATAGCGTCGAAGAATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152678.2-596s21c1
Sequence:CCGGGATCAGCAAACTACCTTATATCTCGAGATATAAGGTAGTTTGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145969
VALIDATED
DENND6A MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 6A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145969.1-1212s1c1
Sequence:CCGGCCTAAGCAAGTTAAAGTGAAACTCGAGTTTCACTTTAACTTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145969.1-1966s1c1
Sequence:CCGGGCACAGCTAACATTCTCCTATCTCGAGATAGGAGAATGTTAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145969.1-323s1c1
Sequence:CCGGGCATTCCAAACTTACTGATAACTCGAGTTATCAGTAAGTTTGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145969.1-1587s1c1
Sequence:CCGGCGGCAGTTTCTAAAGTCTCCACTCGAGTGGAGACTTTAGAAACTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145969.4-1592s21c1
Sequence:CCGGCGGCAGTTTCTAAAGTCTCCACTCGAGTGGAGACTTTAGAAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145969.4-1971s21c1
Sequence:CCGGGCACAGCTAACATTCTCCTATCTCGAGATAGGAGAATGTTAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145969.4-1217s21c1
Sequence:CCGGCCTAAGCAAGTTAAAGTGAAACTCGAGTTTCACTTTAACTTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145969.4-328s21c1
Sequence:CCGGGCATTCCAAACTTACTGATAACTCGAGTTATCAGTAAGTTTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145969
VALIDATED
DENND6A MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 6A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145969.1-1212s1c1
Sequence:CCGGCCTAAGCAAGTTAAAGTGAAACTCGAGTTTCACTTTAACTTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145969.1-1966s1c1
Sequence:CCGGGCACAGCTAACATTCTCCTATCTCGAGATAGGAGAATGTTAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145969.1-323s1c1
Sequence:CCGGGCATTCCAAACTTACTGATAACTCGAGTTATCAGTAAGTTTGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145969.1-1587s1c1
Sequence:CCGGCGGCAGTTTCTAAAGTCTCCACTCGAGTGGAGACTTTAGAAACTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145969.4-1592s21c1
Sequence:CCGGCGGCAGTTTCTAAAGTCTCCACTCGAGTGGAGACTTTAGAAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145969.4-1971s21c1
Sequence:CCGGGCACAGCTAACATTCTCCTATCTCGAGATAGGAGAATGTTAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145969.4-1217s21c1
Sequence:CCGGCCTAAGCAAGTTAAAGTGAAACTCGAGTTTCACTTTAACTTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145969.4-328s21c1
Sequence:CCGGGCATTCCAAACTTACTGATAACTCGAGTTATCAGTAAGTTTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145969
VALIDATED
DENND6A MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 6A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145969.1-1212s1c1
Sequence:CCGGCCTAAGCAAGTTAAAGTGAAACTCGAGTTTCACTTTAACTTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145969.1-1966s1c1
Sequence:CCGGGCACAGCTAACATTCTCCTATCTCGAGATAGGAGAATGTTAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145969.1-323s1c1
Sequence:CCGGGCATTCCAAACTTACTGATAACTCGAGTTATCAGTAAGTTTGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145969.1-1587s1c1
Sequence:CCGGCGGCAGTTTCTAAAGTCTCCACTCGAGTGGAGACTTTAGAAACTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145969.4-1592s21c1
Sequence:CCGGCGGCAGTTTCTAAAGTCTCCACTCGAGTGGAGACTTTAGAAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145969.4-1971s21c1
Sequence:CCGGGCACAGCTAACATTCTCCTATCTCGAGATAGGAGAATGTTAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145969.4-1217s21c1
Sequence:CCGGCCTAAGCAAGTTAAAGTGAAACTCGAGTTTCACTTTAACTTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145969.4-328s21c1
Sequence:CCGGGCATTCCAAACTTACTGATAACTCGAGTTATCAGTAAGTTTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks