EMAIL THIS PAGE TO A FRIEND

DENND6B

DENN/MADD domain containing 6B

Synonyms: AFI1B FAM116B
UniProtKB ID: Q8NEG7, A6X8I5
Gene ID:
Mouse(69440) DENN/MADD domain containing 6B
Rat(362983) DENN/MADD domain containing 6B
Zebrafish(337436) DENN/MADD domain containing 6B
domestic cat(101081648) DENN/MADD domain containing 6B
domestic guinea pig(100720657) DENN/MADD domain containing 6B
naked mole-rat(101703001) DENN/MADD domain containing 6B
sheep(101116722) DENN/MADD domain containing 6B
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001794 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001794 Rosetta Predictions human pricing
NM_001108749 Rosetta Predictions rat pricing
NM_027081 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021130 predicted 854
2 SASI_Hs01_00021131 predicted 1607
3 SASI_Hs01_00021133 predicted 1489
4 SASI_Hs01_00021134 predicted 1569
5 SASI_Hs01_00021135 predicted 682
6 SASI_Hs01_00021136 predicted 980
7 SASI_Hs01_00021138 predicted 1625
8 SASI_Hs01_00021139 predicted 453
9 SASI_Hs02_00303944 predicted 1066
10 SASI_Hs02_00303945 predicted 1246
11 SASI_Hs01_00021132 predicted 454
12 SASI_Hs01_00021137 predicted 1634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241705 predicted 811
2 SASI_Rn02_00241706 predicted 337
3 SASI_Rn02_00241707 predicted 680
4 SASI_Rn02_00241708 predicted 452
5 SASI_Rn02_00241709 predicted 1791
6 SASI_Rn02_00241710 predicted 1147
7 SASI_Rn02_00241711 predicted 1044
8 SASI_Rn02_00241712 predicted 673
9 SASI_Rn02_00241713 predicted 465
10 SASI_Rn02_00241714 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073892 predicted 1157
2 SASI_Mm01_00073893 predicted 1765
3 SASI_Mm01_00073894 predicted 562
4 SASI_Mm01_00073895 predicted 807
5 SASI_Mm01_00073896 predicted 458
6 SASI_Mm01_00073897 predicted 403
7 SASI_Mm01_00073898 predicted 1877
8 SASI_Mm02_00331507 predicted 1328
9 SASI_Mm01_00073900 predicted 794
10 SASI_Mm01_00073901 predicted 351
11 SASI_Mm01_00073899 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001794
DENND6B MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 6B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-1153s1c1
Sequence:CCGGCCTAAGCAAGTCAAGCTGAAACTCGAGTTTCAGCTTGACTTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-1067s1c1
Sequence:CCGGGAGTCACAAACCCTTTCTTTACTCGAGTAAAGAAAGGGTTTGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-1686s1c1
Sequence:CCGGCCTGAAACTTCGTGAGAAGCTCTCGAGAGCTTCTCACGAAGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-846s1c1
Sequence:CCGGGCTGACTCATATGCAGACACTCTCGAGAGTGTCTGCATATGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-1632s1c1
Sequence:CCGGGAACATCGAGACCTGGATGAACTCGAGTTCATCCAGGTCTCGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-755s1c1
Sequence:CCGGCGAAGCAGTTTGACCAAGAGACTCGAGTCTCTTGGTCAAACTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001794
DENND6B MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 6B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-1153s1c1
Sequence:CCGGCCTAAGCAAGTCAAGCTGAAACTCGAGTTTCAGCTTGACTTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-1067s1c1
Sequence:CCGGGAGTCACAAACCCTTTCTTTACTCGAGTAAAGAAAGGGTTTGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-1686s1c1
Sequence:CCGGCCTGAAACTTCGTGAGAAGCTCTCGAGAGCTTCTCACGAAGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-846s1c1
Sequence:CCGGGCTGACTCATATGCAGACACTCTCGAGAGTGTCTGCATATGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-1632s1c1
Sequence:CCGGGAACATCGAGACCTGGATGAACTCGAGTTCATCCAGGTCTCGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-755s1c1
Sequence:CCGGCGAAGCAGTTTGACCAAGAGACTCGAGTCTCTTGGTCAAACTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001794
DENND6B MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 6B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-1153s1c1
Sequence:CCGGCCTAAGCAAGTCAAGCTGAAACTCGAGTTTCAGCTTGACTTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-1067s1c1
Sequence:CCGGGAGTCACAAACCCTTTCTTTACTCGAGTAAAGAAAGGGTTTGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-1686s1c1
Sequence:CCGGCCTGAAACTTCGTGAGAAGCTCTCGAGAGCTTCTCACGAAGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-846s1c1
Sequence:CCGGGCTGACTCATATGCAGACACTCTCGAGAGTGTCTGCATATGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-1632s1c1
Sequence:CCGGGAACATCGAGACCTGGATGAACTCGAGTTCATCCAGGTCTCGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001794.1-755s1c1
Sequence:CCGGCGAAGCAGTTTGACCAAGAGACTCGAGTCTCTTGGTCAAACTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027081
DENND6B MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 6B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000196236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027081.1-398s1c1
Sequence:CCGGGCTGCTTAAACGACTGCTCAACTCGAGTTGAGCAGTCGTTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027081.1-110s1c1
Sequence:CCGGCCTGAAGTTCTGCTGTGACTTCTCGAGAAGTCACAGCAGAACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027081.1-297s1c1
Sequence:CCGGCCAAAGCAGGTCAAGCTTAAACTCGAGTTTAAGCTTGACCTGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027081.1-918s1c1
Sequence:CCGGGATACAGTTATTGGCTCCCTTCTCGAGAAGGGAGCCAATAACTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027081
DENND6B MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 6B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000196236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027081.1-398s1c1
Sequence:CCGGGCTGCTTAAACGACTGCTCAACTCGAGTTGAGCAGTCGTTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027081.1-110s1c1
Sequence:CCGGCCTGAAGTTCTGCTGTGACTTCTCGAGAAGTCACAGCAGAACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027081.1-297s1c1
Sequence:CCGGCCAAAGCAGGTCAAGCTTAAACTCGAGTTTAAGCTTGACCTGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027081.1-918s1c1
Sequence:CCGGGATACAGTTATTGGCTCCCTTCTCGAGAAGGGAGCCAATAACTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027081
DENND6B MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 6B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000196236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027081.1-398s1c1
Sequence:CCGGGCTGCTTAAACGACTGCTCAACTCGAGTTGAGCAGTCGTTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027081.1-110s1c1
Sequence:CCGGCCTGAAGTTCTGCTGTGACTTCTCGAGAAGTCACAGCAGAACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027081.1-297s1c1
Sequence:CCGGCCAAAGCAGGTCAAGCTTAAACTCGAGTTTAAGCTTGACCTGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027081.1-918s1c1
Sequence:CCGGGATACAGTTATTGGCTCCCTTCTCGAGAAGGGAGCCAATAACTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks