EMAIL THIS PAGE TO A FRIEND

DENR

density-regulated protein

Synonyms: DRP DRP1 SMAP-3
UniProtKB ID: O43583, Q9H3U6, Q9UKZ0
Gene ID:
Human(8562) Summary: This gene encodes a protein whose expression was found to increase in cultured cells at high density but not during growth arrest. This gene was also shown to have increased expression in cells overexpressing HER-2/neu proto-oncogene. The protein contains an SUI1 domain. In budding yeast, SUI1 is a translation initiation factor that along with eIF-2 and the initiator tRNA-Met, directs the ribosome to the proper translation start site. Proteins similar to SUI have been found in mammals, insects, and plants. [provided by RefSeq, Jul 2008]
Mouse(68184) density-regulated protein
Rat(360806) density-regulated protein
Goat(100861130) density-regulated protein
sheep(101119506) density-regulated protein
naked mole-rat(101713911) density-regulated protein
domestic guinea pig(100723053) density-regulated protein
Zebrafish(436970) density-regulated protein
cow(614238) density-regulated protein
domestic cat(101091229) density-regulated protein
dog(610709) density-regulated protein
chicken(771794) density-regulated protein
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003677 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003677 Rosetta Predictions human pricing
NM_026603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161819 predicted 198
2 SASI_Hs01_00161821 predicted 351
3 SASI_Hs01_00161822 predicted 235
4 SASI_Hs01_00161823 predicted 249
5 SASI_Hs01_00161824 predicted 516
6 SASI_Hs01_00161825 predicted 499
7 SASI_Hs01_00161826 predicted 248
8 SASI_Hs01_00161827 predicted 350
9 SASI_Hs01_00161828 predicted 206
10 SASI_Hs02_00336079 predicted 214
11 SASI_Hs01_00161820 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194228 predicted 711
2 SASI_Mm01_00194229 predicted 683
3 SASI_Mm01_00194231 predicted 190
4 SASI_Mm02_00330565 predicted 255
5 SASI_Mm01_00194232 predicted 468
6 SASI_Mm01_00194233 predicted 239
7 SASI_Mm01_00194234 predicted 163
8 SASI_Mm01_00194235 predicted 514
9 SASI_Mm01_00194236 predicted 174
10 SASI_Mm02_00330566 predicted 319
11 SASI_Mm01_00194230 predicted 157
12 SASI_Mm01_00194237 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003677
VALIDATED
DENR MISSION shRNA Bacterial Glycerol Stock
density-regulated protein
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003677.2-496s1c1
Sequence:CCGGCAAGAGTATGTGGCCTTGCAACTCGAGTTGCAAGGCCACATACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003677.2-169s1c1
Sequence:CCGGGTGCCAAGTTAGATGCCGATTCTCGAGAATCGGCATCTAACTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003677.2-492s1c1
Sequence:CCGGGTGACAAGAGTATGTGGCCTTCTCGAGAAGGCCACATACTCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003677.2-339s1c1
Sequence:CCGGGAAGCTGGAATTAGTGAGGGTCTCGAGACCCTCACTAATTCCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003677.2-159s1c1
Sequence:CCGGCCAAGGAACAGTGCCAAGTTACTCGAGTAACTTGGCACTGTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003677.2-199s1c1
Sequence:CCGGGAGTCCTTTATTGTGGAGTCTCTCGAGAGACTCCACAATAAAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003677.2-663s1c1
Sequence:CCGGGTAGATGATGACAGCATCGAACTCGAGTTCGATGCTGTCATCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003677.2-666s1c1
Sequence:CCGGGATGATGACAGCATCGAAGATCTCGAGATCTTCGATGCTGTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003677.2-234s1c1
Sequence:CCGGGAGTACTGTGAATATATGCCTCTCGAGAGGCATATATTCACAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003677.2-331s1c1
Sequence:CCGGCCAAACAAGAAGCTGGAATTACTCGAGTAATTCCAGCTTCTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003677.2-346s1c1
Sequence:CCGGGAATTAGTGAGGGTCAAGGAACTCGAGTTCCTTGACCCTCACTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003677.3-195s21c1
Sequence:CCGGGTGCCAAGTTAGATGCCGATTCTCGAGAATCGGCATCTAACTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003677.3-522s21c1
Sequence:CCGGCAAGAGTATGTGGCCTTGCAACTCGAGTTGCAAGGCCACATACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003677.3-692s21c1
Sequence:CCGGGATGATGACAGCATCGAAGATCTCGAGATCTTCGATGCTGTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003677.3-372s21c1
Sequence:CCGGGAATTAGTGAGGGTCAAGGAACTCGAGTTCCTTGACCCTCACTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003677
VALIDATED
DENR MISSION shRNA shRNA Plasmid DNA
density-regulated protein
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003677.2-496s1c1
Sequence:CCGGCAAGAGTATGTGGCCTTGCAACTCGAGTTGCAAGGCCACATACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003677.2-169s1c1
Sequence:CCGGGTGCCAAGTTAGATGCCGATTCTCGAGAATCGGCATCTAACTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003677.2-492s1c1
Sequence:CCGGGTGACAAGAGTATGTGGCCTTCTCGAGAAGGCCACATACTCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003677.2-339s1c1
Sequence:CCGGGAAGCTGGAATTAGTGAGGGTCTCGAGACCCTCACTAATTCCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003677.2-159s1c1
Sequence:CCGGCCAAGGAACAGTGCCAAGTTACTCGAGTAACTTGGCACTGTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003677.2-199s1c1
Sequence:CCGGGAGTCCTTTATTGTGGAGTCTCTCGAGAGACTCCACAATAAAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003677.2-663s1c1
Sequence:CCGGGTAGATGATGACAGCATCGAACTCGAGTTCGATGCTGTCATCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003677.2-666s1c1
Sequence:CCGGGATGATGACAGCATCGAAGATCTCGAGATCTTCGATGCTGTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003677.2-234s1c1
Sequence:CCGGGAGTACTGTGAATATATGCCTCTCGAGAGGCATATATTCACAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003677.2-331s1c1
Sequence:CCGGCCAAACAAGAAGCTGGAATTACTCGAGTAATTCCAGCTTCTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003677.2-346s1c1
Sequence:CCGGGAATTAGTGAGGGTCAAGGAACTCGAGTTCCTTGACCCTCACTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003677.3-195s21c1
Sequence:CCGGGTGCCAAGTTAGATGCCGATTCTCGAGAATCGGCATCTAACTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003677.3-522s21c1
Sequence:CCGGCAAGAGTATGTGGCCTTGCAACTCGAGTTGCAAGGCCACATACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003677.3-692s21c1
Sequence:CCGGGATGATGACAGCATCGAAGATCTCGAGATCTTCGATGCTGTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003677.3-372s21c1
Sequence:CCGGGAATTAGTGAGGGTCAAGGAACTCGAGTTCCTTGACCCTCACTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003677
VALIDATED
DENR MISSION shRNA Lentiviral Transduction Particles
density-regulated protein
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003677.2-496s1c1
Sequence:CCGGCAAGAGTATGTGGCCTTGCAACTCGAGTTGCAAGGCCACATACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003677.2-169s1c1
Sequence:CCGGGTGCCAAGTTAGATGCCGATTCTCGAGAATCGGCATCTAACTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003677.2-492s1c1
Sequence:CCGGGTGACAAGAGTATGTGGCCTTCTCGAGAAGGCCACATACTCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003677.2-339s1c1
Sequence:CCGGGAAGCTGGAATTAGTGAGGGTCTCGAGACCCTCACTAATTCCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003677.2-159s1c1
Sequence:CCGGCCAAGGAACAGTGCCAAGTTACTCGAGTAACTTGGCACTGTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003677.2-199s1c1
Sequence:CCGGGAGTCCTTTATTGTGGAGTCTCTCGAGAGACTCCACAATAAAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003677.2-663s1c1
Sequence:CCGGGTAGATGATGACAGCATCGAACTCGAGTTCGATGCTGTCATCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003677.2-666s1c1
Sequence:CCGGGATGATGACAGCATCGAAGATCTCGAGATCTTCGATGCTGTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003677.2-234s1c1
Sequence:CCGGGAGTACTGTGAATATATGCCTCTCGAGAGGCATATATTCACAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003677.2-331s1c1
Sequence:CCGGCCAAACAAGAAGCTGGAATTACTCGAGTAATTCCAGCTTCTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003677.2-346s1c1
Sequence:CCGGGAATTAGTGAGGGTCAAGGAACTCGAGTTCCTTGACCCTCACTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003677.3-195s21c1
Sequence:CCGGGTGCCAAGTTAGATGCCGATTCTCGAGAATCGGCATCTAACTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003677.3-522s21c1
Sequence:CCGGCAAGAGTATGTGGCCTTGCAACTCGAGTTGCAAGGCCACATACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003677.3-692s21c1
Sequence:CCGGGATGATGACAGCATCGAAGATCTCGAGATCTTCGATGCTGTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003677.3-372s21c1
Sequence:CCGGGAATTAGTGAGGGTCAAGGAACTCGAGTTCCTTGACCCTCACTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026603
VALIDATED
DENR MISSION shRNA Bacterial Glycerol Stock
density-regulated protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026603.1-1891s1c1
Sequence:CCGGCGTCACAAACACAAGTTGTTACTCGAGTAACAACTTGTGTTTGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026603.1-147s1c1
Sequence:CCGGCGATACGAAGAACAGTGCCAACTCGAGTTGGCACTGTTCTTCGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026603.1-265s1c1
Sequence:CCGGCAATGGCTAGAGAAGAACTTTCTCGAGAAAGTTCTTCTCTAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026603.1-433s1c1
Sequence:CCGGGTACCACAGAAGGTCACGATACTCGAGTATCGTGACCTTCTGTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026603.1-161s1c1
Sequence:CCGGGTGCCAAGTTAGATGCGGATTCTCGAGAATCCGCATCTAACTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-955s21c1
Sequence:CCGGGACTCTGAATTTAGTCAAATACTCGAGTATTTGACTAAATTCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-754s21c1
Sequence:CCGGAGAGGCCTTTCAGAATATATACTCGAGTATATATTCTGAAAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-146s21c1
Sequence:CCGGCGATACGAAGAACAGTGCCAACTCGAGTTGGCACTGTTCTTCGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-264s21c1
Sequence:CCGGCAATGGCTAGAGAAGAACTTTCTCGAGAAAGTTCTTCTCTAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-432s21c1
Sequence:CCGGGTACCACAGAAGGTCACGATACTCGAGTATCGTGACCTTCTGTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026603
VALIDATED
DENR MISSION shRNA shRNA Plasmid DNA
density-regulated protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026603.1-1891s1c1
Sequence:CCGGCGTCACAAACACAAGTTGTTACTCGAGTAACAACTTGTGTTTGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026603.1-147s1c1
Sequence:CCGGCGATACGAAGAACAGTGCCAACTCGAGTTGGCACTGTTCTTCGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026603.1-265s1c1
Sequence:CCGGCAATGGCTAGAGAAGAACTTTCTCGAGAAAGTTCTTCTCTAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026603.1-433s1c1
Sequence:CCGGGTACCACAGAAGGTCACGATACTCGAGTATCGTGACCTTCTGTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026603.1-161s1c1
Sequence:CCGGGTGCCAAGTTAGATGCGGATTCTCGAGAATCCGCATCTAACTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-955s21c1
Sequence:CCGGGACTCTGAATTTAGTCAAATACTCGAGTATTTGACTAAATTCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-754s21c1
Sequence:CCGGAGAGGCCTTTCAGAATATATACTCGAGTATATATTCTGAAAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-146s21c1
Sequence:CCGGCGATACGAAGAACAGTGCCAACTCGAGTTGGCACTGTTCTTCGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-264s21c1
Sequence:CCGGCAATGGCTAGAGAAGAACTTTCTCGAGAAAGTTCTTCTCTAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-432s21c1
Sequence:CCGGGTACCACAGAAGGTCACGATACTCGAGTATCGTGACCTTCTGTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026603
VALIDATED
DENR MISSION shRNA Lentiviral Transduction Particles
density-regulated protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026603.1-1891s1c1
Sequence:CCGGCGTCACAAACACAAGTTGTTACTCGAGTAACAACTTGTGTTTGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026603.1-147s1c1
Sequence:CCGGCGATACGAAGAACAGTGCCAACTCGAGTTGGCACTGTTCTTCGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026603.1-265s1c1
Sequence:CCGGCAATGGCTAGAGAAGAACTTTCTCGAGAAAGTTCTTCTCTAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026603.1-433s1c1
Sequence:CCGGGTACCACAGAAGGTCACGATACTCGAGTATCGTGACCTTCTGTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026603.1-161s1c1
Sequence:CCGGGTGCCAAGTTAGATGCGGATTCTCGAGAATCCGCATCTAACTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-955s21c1
Sequence:CCGGGACTCTGAATTTAGTCAAATACTCGAGTATTTGACTAAATTCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-754s21c1
Sequence:CCGGAGAGGCCTTTCAGAATATATACTCGAGTATATATTCTGAAAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-146s21c1
Sequence:CCGGCGATACGAAGAACAGTGCCAACTCGAGTTGGCACTGTTCTTCGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-264s21c1
Sequence:CCGGCAATGGCTAGAGAAGAACTTTCTCGAGAAAGTTCTTCTCTAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026603.4-432s21c1
Sequence:CCGGGTACCACAGAAGGTCACGATACTCGAGTATCGTGACCTTCTGTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks