EMAIL THIS PAGE TO A FRIEND

DEPDC1

DEP domain containing 1

66 Gene Product Result for
Synonyms: DEP.8 DEPDC1-V2 DEPDC1A SDP35
Gene ID:
Rat(295538) DEP domain containing 1
sheep(101116779) DEP domain containing 1
domestic guinea pig(100718729) DEP domain containing 1
naked mole-rat(101723670) DEP domain containing 1
chicken(424710) DEP domain containing 1
domestic cat(101090280) DEP domain containing 1
Horse(100068767) DEP domain containing 1
cow(527397) DEP domain containing 1
dog(479992) DEP domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017779 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128201 MISSION® esiRNA esiRNA human DEPDC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114120 Rosetta Predictions human pricing
NM_017779 Rosetta Predictions human pricing
XM_001080406 Rosetta Predictions rat pricing
XM_227798 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326294 predicted 699
2 SASI_Hs02_00326295 predicted 270
3 SASI_Hs02_00326296 predicted 308
4 SASI_Hs02_00326297 predicted 264
5 SASI_Hs02_00326298 predicted 339
6 SASI_Hs02_00326299 predicted 345
7 SASI_Hs02_00326300 predicted 789
8 SASI_Hs02_00326301 predicted 277
9 SASI_Hs02_00326302 predicted 777
10 SASI_Hs02_00326303 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139175 predicted 694
2 SASI_Hs02_00350619 predicted 270
3 SASI_Hs01_00139180 predicted 306
4 SASI_Hs02_00350620 predicted 263
5 SASI_Hs02_00350621 predicted 344
6 SASI_Hs02_00350622 predicted 345
7 SASI_Hs01_00139181 predicted 789
8 SASI_Hs02_00350623 predicted 278
9 SASI_Hs02_00350624 predicted 781
10 SASI_Hs02_00350625 predicted 274
11 SASI_Hs01_00139174 predicted 596
12 SASI_Hs01_00139176 predicted 1018
13 SASI_Hs01_00139177 predicted 845
14 SASI_Hs01_00139178 predicted 798
15 SASI_Hs01_00139179 predicted 1032
16 SASI_Hs01_00139182 predicted 610
17 SASI_Hs01_00139183 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367899 predicted 917
2 SASI_Rn02_00367900 predicted 1345
3 SASI_Rn02_00367901 predicted 1923
4 SASI_Rn02_00367902 predicted 430
5 SASI_Rn02_00367903 predicted 411
6 SASI_Rn02_00367904 predicted 838
7 SASI_Rn02_00367905 predicted 656
8 SASI_Rn02_00367906 predicted 1188
9 SASI_Rn02_00367907 predicted 1747
10 SASI_Rn02_00367908 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384724 predicted 915
2 SASI_Rn02_00384725 predicted 1346
3 SASI_Rn02_00384726 predicted 1922
4 SASI_Rn02_00384727 predicted 426
5 SASI_Rn02_00384728 predicted 410
6 SASI_Rn02_00384729 predicted 843
7 SASI_Rn02_00384730 predicted 658
8 SASI_Rn02_00384731 predicted 1189
9 SASI_Rn02_00384732 predicted 1749
10 SASI_Rn02_00384733 predicted 476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017779
VALIDATED
DEPDC1 MISSION shRNA Bacterial Glycerol Stock
DEP domain containing 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-1686s21c1
Sequence:CCGGCCGTAGTCTAAGATAACTAACCTCGAGGTTAGTTATCTTAGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-885s21c1
Sequence:CCGGTTGGCCAAGAAGCAATGATATCTCGAGATATCATTGCTTCTTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017779.4-268s21c1
Sequence:CCGGGATTGGCTTTATGACCTATTACTCGAGTAATAGGTCATAAAGCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-944s21c1
Sequence:CCGGTCAGAACAATCGCAGATTATTCTCGAGAATAATCTGCGATTGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-841s21c1
Sequence:CCGGGACCTCCCTCACTGGGTATTACTCGAGTAATACCCAGTGAGGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-803s21c1
Sequence:CCGGGTAAACGTGGAGTAGTTATACCTCGAGGTATAACTACTCCACGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-436s21c1
Sequence:CCGGCCTGCAACTTCGCCACTTAAACTCGAGTTTAAGTGGCGAAGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017779.3-1352s1c1
Sequence:CCGGGCTCAGGAGTTTGATGAGCAACTCGAGTTGCTCATCAAACTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138654    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017779.3-2453s1c1
Sequence:CCGGCCCACTGAAATCAGGGCATATCTCGAGATATGCCCTGATTTCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017779.3-830s1c1
Sequence:CCGGGTTGGATTTGAACGAGATGTACTCGAGTACATCTCGTTCAAATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017779.3-1842s1c1
Sequence:CCGGGCTATCCAGTAAGGCTATCATCTCGAGATGATAGCCTTACTGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017779.3-232s1c1
Sequence:CCGGGCAACAGACTATCCAACTGTTCTCGAGAACAGTTGGATAGTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017779.3-1299s1c1
Sequence:CCGGGAGATGGACTATTTGCTCCTTCTCGAGAAGGAGCAAATAGTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017779.3-2069s1c1
Sequence:CCGGGCTGCCAAATGTTGCACTCTTCTCGAGAAGAGTGCAACATTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017779.3-2589s1c1
Sequence:CCGGCCAGGGCCTAACTTACACTAACTCGAGTTAGTGTAAGTTAGGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017779
VALIDATED
DEPDC1 MISSION shRNA shRNA Plasmid DNA
DEP domain containing 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-1686s21c1
Sequence:CCGGCCGTAGTCTAAGATAACTAACCTCGAGGTTAGTTATCTTAGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-885s21c1
Sequence:CCGGTTGGCCAAGAAGCAATGATATCTCGAGATATCATTGCTTCTTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017779.4-268s21c1
Sequence:CCGGGATTGGCTTTATGACCTATTACTCGAGTAATAGGTCATAAAGCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-944s21c1
Sequence:CCGGTCAGAACAATCGCAGATTATTCTCGAGAATAATCTGCGATTGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-841s21c1
Sequence:CCGGGACCTCCCTCACTGGGTATTACTCGAGTAATACCCAGTGAGGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-803s21c1
Sequence:CCGGGTAAACGTGGAGTAGTTATACCTCGAGGTATAACTACTCCACGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-436s21c1
Sequence:CCGGCCTGCAACTTCGCCACTTAAACTCGAGTTTAAGTGGCGAAGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017779.3-1352s1c1
Sequence:CCGGGCTCAGGAGTTTGATGAGCAACTCGAGTTGCTCATCAAACTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138654    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017779.3-2453s1c1
Sequence:CCGGCCCACTGAAATCAGGGCATATCTCGAGATATGCCCTGATTTCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017779.3-830s1c1
Sequence:CCGGGTTGGATTTGAACGAGATGTACTCGAGTACATCTCGTTCAAATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017779.3-1842s1c1
Sequence:CCGGGCTATCCAGTAAGGCTATCATCTCGAGATGATAGCCTTACTGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017779.3-232s1c1
Sequence:CCGGGCAACAGACTATCCAACTGTTCTCGAGAACAGTTGGATAGTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017779.3-1299s1c1
Sequence:CCGGGAGATGGACTATTTGCTCCTTCTCGAGAAGGAGCAAATAGTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017779.3-2069s1c1
Sequence:CCGGGCTGCCAAATGTTGCACTCTTCTCGAGAAGAGTGCAACATTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017779.3-2589s1c1
Sequence:CCGGCCAGGGCCTAACTTACACTAACTCGAGTTAGTGTAAGTTAGGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017779
VALIDATED
DEPDC1 MISSION shRNA Lentiviral Transduction Particles
DEP domain containing 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-1686s21c1
Sequence:CCGGCCGTAGTCTAAGATAACTAACCTCGAGGTTAGTTATCTTAGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-885s21c1
Sequence:CCGGTTGGCCAAGAAGCAATGATATCTCGAGATATCATTGCTTCTTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017779.4-268s21c1
Sequence:CCGGGATTGGCTTTATGACCTATTACTCGAGTAATAGGTCATAAAGCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-944s21c1
Sequence:CCGGTCAGAACAATCGCAGATTATTCTCGAGAATAATCTGCGATTGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-841s21c1
Sequence:CCGGGACCTCCCTCACTGGGTATTACTCGAGTAATACCCAGTGAGGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-803s21c1
Sequence:CCGGGTAAACGTGGAGTAGTTATACCTCGAGGTATAACTACTCCACGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017779.4-436s21c1
Sequence:CCGGCCTGCAACTTCGCCACTTAAACTCGAGTTTAAGTGGCGAAGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017779.3-1352s1c1
Sequence:CCGGGCTCAGGAGTTTGATGAGCAACTCGAGTTGCTCATCAAACTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138654    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017779.3-2453s1c1
Sequence:CCGGCCCACTGAAATCAGGGCATATCTCGAGATATGCCCTGATTTCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017779.3-830s1c1
Sequence:CCGGGTTGGATTTGAACGAGATGTACTCGAGTACATCTCGTTCAAATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017779.3-1842s1c1
Sequence:CCGGGCTATCCAGTAAGGCTATCATCTCGAGATGATAGCCTTACTGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017779.3-232s1c1
Sequence:CCGGGCAACAGACTATCCAACTGTTCTCGAGAACAGTTGGATAGTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017779.3-1299s1c1
Sequence:CCGGGAGATGGACTATTTGCTCCTTCTCGAGAAGGAGCAAATAGTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017779.3-2069s1c1
Sequence:CCGGGCTGCCAAATGTTGCACTCTTCTCGAGAAGAGTGCAACATTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017779.3-2589s1c1
Sequence:CCGGCCAGGGCCTAACTTACACTAACTCGAGTTAGTGTAAGTTAGGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks