EMAIL THIS PAGE TO A FRIEND

DEPDC1B

DEP domain containing 1B

59 Gene Product Result for
Synonyms: BRCC3 XTP1
Gene ID:
Mouse(218581) DEP domain containing 1B
Rat(310074) DEP domain containing 1B
sheep(101112261) DEP domain containing 1B
naked mole-rat(101704772) DEP domain containing 1B
domestic guinea pig(100736207) DEP domain containing 1B
Zebrafish(100006170) DEP domain containing 1B
chicken(427152) DEP domain containing 1B
dog(608968) DEP domain containing 1B
Horse(100060496) DEP domain containing 1B
cow(540874) DEP domain containing 1B
domestic cat(101098112) DEP domain containing 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178683 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178683 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178683 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018369 Rosetta Predictions human pricing
NM_001107651 Rosetta Predictions rat pricing
NM_178683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191386 predicted 857
2 SASI_Hs01_00191388 predicted 1393
3 SASI_Hs01_00191389 predicted 1259
4 SASI_Hs01_00191390 predicted 224
5 SASI_Hs01_00191391 predicted 1666
6 SASI_Hs01_00191392 predicted 1291
7 SASI_Hs01_00191393 predicted 574
8 SASI_Hs01_00191394 predicted 322
9 SASI_Hs01_00191395 predicted 594
10 SASI_Hs02_00351841 predicted 1417
11 SASI_Hs01_00191387 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230925 predicted 704
2 SASI_Rn02_00230926 predicted 450
3 SASI_Rn02_00230927 predicted 1722
4 SASI_Rn02_00230928 predicted 705
5 SASI_Rn02_00230929 predicted 1226
6 SASI_Rn02_00230930 predicted 1659
7 SASI_Rn02_00230931 predicted 731
8 SASI_Rn02_00230932 predicted 1006
9 SASI_Rn02_00230933 predicted 1730
10 SASI_Rn02_00230934 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349159 predicted 862
2 SASI_Mm01_00175906 predicted 1334
3 SASI_Mm01_00175907 predicted 885
4 SASI_Mm01_00175908 predicted 1212
5 SASI_Mm01_00175909 predicted 1006
6 SASI_Mm01_00175910 predicted 629
7 SASI_Mm01_00175911 predicted 444
8 SASI_Mm01_00175912 predicted 952
9 SASI_Mm01_00175913 predicted 1057
10 SASI_Mm01_00175915 predicted 833
11 SASI_Mm01_00175914 predicted 1188
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018369
DEPDC1B MISSION shRNA Bacterial Glycerol Stock
DEP domain containing 1B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018369.2-363s21c1
Sequence:CCGGTTGAAGACAATCGTCACTTATCTCGAGATAAGTGACGATTGTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-1560s1c1
Sequence:CCGGGCTGCTAATGTGGGCACTAAACTCGAGTTTAGTGCCCACATTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-1333s1c1
Sequence:CCGGCGTCAAATTAGTCCAGAGGAACTCGAGTTCCTCTGGACTAATTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-136s1c1
Sequence:CCGGCGCTGTCGTTTCAAGAGCTATCTCGAGATAGCTCTTGAAACGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-816s1c1
Sequence:CCGGGCAGCCTATGTACTTGGGATTCTCGAGAATCCCAAGTACATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-1168s1c1
Sequence:CCGGGCTGCTAGATTGGTAACGTTTCTCGAGAAACGTTACCAATCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018369
DEPDC1B MISSION shRNA shRNA Plasmid DNA
DEP domain containing 1B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018369.2-363s21c1
Sequence:CCGGTTGAAGACAATCGTCACTTATCTCGAGATAAGTGACGATTGTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-1560s1c1
Sequence:CCGGGCTGCTAATGTGGGCACTAAACTCGAGTTTAGTGCCCACATTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-1333s1c1
Sequence:CCGGCGTCAAATTAGTCCAGAGGAACTCGAGTTCCTCTGGACTAATTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-136s1c1
Sequence:CCGGCGCTGTCGTTTCAAGAGCTATCTCGAGATAGCTCTTGAAACGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-816s1c1
Sequence:CCGGGCAGCCTATGTACTTGGGATTCTCGAGAATCCCAAGTACATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-1168s1c1
Sequence:CCGGGCTGCTAGATTGGTAACGTTTCTCGAGAAACGTTACCAATCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018369
DEPDC1B MISSION shRNA Lentiviral Transduction Particles
DEP domain containing 1B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018369.2-363s21c1
Sequence:CCGGTTGAAGACAATCGTCACTTATCTCGAGATAAGTGACGATTGTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-1560s1c1
Sequence:CCGGGCTGCTAATGTGGGCACTAAACTCGAGTTTAGTGCCCACATTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-1333s1c1
Sequence:CCGGCGTCAAATTAGTCCAGAGGAACTCGAGTTCCTCTGGACTAATTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-136s1c1
Sequence:CCGGCGCTGTCGTTTCAAGAGCTATCTCGAGATAGCTCTTGAAACGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-816s1c1
Sequence:CCGGGCAGCCTATGTACTTGGGATTCTCGAGAATCCCAAGTACATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018369.1-1168s1c1
Sequence:CCGGGCTGCTAGATTGGTAACGTTTCTCGAGAAACGTTACCAATCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178683
VALIDATED
DEPDC1B MISSION shRNA Bacterial Glycerol Stock
DEP domain containing 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178683.2-1008s1c1
Sequence:CCGGGCCATTGAAGCATTTCAGCTTCTCGAGAAGCTGAAATGCTTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178683.2-1458s1c1
Sequence:CCGGGAAGTCATAGCCGACGACAAACTCGAGTTTGTCGTCGGCTATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178683.2-866s1c1
Sequence:CCGGGCAGCCTATGTACTTGGGATTCTCGAGAATCCCAAGTACATAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178683.2-1009s1c1
Sequence:CCGGCCATTGAAGCATTTCAGCTTTCTCGAGAAAGCTGAAATGCTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178683.2-1179s1c1
Sequence:CCGGCTGTGCTCTAAGGATGAAGTACTCGAGTACTTCATCCTTAGAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178683
VALIDATED
DEPDC1B MISSION shRNA shRNA Plasmid DNA
DEP domain containing 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178683.2-1008s1c1
Sequence:CCGGGCCATTGAAGCATTTCAGCTTCTCGAGAAGCTGAAATGCTTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178683.2-1458s1c1
Sequence:CCGGGAAGTCATAGCCGACGACAAACTCGAGTTTGTCGTCGGCTATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178683.2-866s1c1
Sequence:CCGGGCAGCCTATGTACTTGGGATTCTCGAGAATCCCAAGTACATAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178683.2-1009s1c1
Sequence:CCGGCCATTGAAGCATTTCAGCTTTCTCGAGAAAGCTGAAATGCTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178683.2-1179s1c1
Sequence:CCGGCTGTGCTCTAAGGATGAAGTACTCGAGTACTTCATCCTTAGAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178683
VALIDATED
DEPDC1B MISSION shRNA Lentiviral Transduction Particles
DEP domain containing 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178683.2-1008s1c1
Sequence:CCGGGCCATTGAAGCATTTCAGCTTCTCGAGAAGCTGAAATGCTTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178683.2-1458s1c1
Sequence:CCGGGAAGTCATAGCCGACGACAAACTCGAGTTTGTCGTCGGCTATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178683.2-866s1c1
Sequence:CCGGGCAGCCTATGTACTTGGGATTCTCGAGAATCCCAAGTACATAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178683.2-1009s1c1
Sequence:CCGGCCATTGAAGCATTTCAGCTTTCTCGAGAAAGCTGAAATGCTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178683.2-1179s1c1
Sequence:CCGGCTGTGCTCTAAGGATGAAGTACTCGAGTACTTCATCCTTAGAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks