EMAIL THIS PAGE TO A FRIEND

DEPDC4

DEP domain containing 4

53 Gene Product Result for
Synonyms: DEP.4
UniProtKB ID: Q8N2C3, Q496C8, Q96BW0
Gene ID:
dog(100687069) DEP domain containing 4
domestic cat(101080465) DEP domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA039323 Anti-DEPDC4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152317 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027891 MISSION® esiRNA esiRNA human DEPDC4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152317 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071963 predicted 465
2 SASI_Hs01_00071964 predicted 647
3 SASI_Hs01_00071965 predicted 816
4 SASI_Hs01_00071966 predicted 803
5 SASI_Hs01_00071967 predicted 588
6 SASI_Hs01_00071968 predicted 433
7 SASI_Hs01_00071969 predicted 295
8 SASI_Hs01_00071970 predicted 819
9 SASI_Hs01_00071971 predicted 815
10 SASI_Hs01_00071972 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152317
DEPDC4 MISSION shRNA Bacterial Glycerol Stock
DEP domain containing 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152317.1-1635s1c1
Sequence:CCGGCCTGACTGACTGTAACCTCAACTCGAGTTGAGGTTACAGTCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152317.1-173s1c1
Sequence:CCGGCCTTTCAAGCTACTCAGCTATCTCGAGATAGCTGAGTAGCTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152317.1-862s1c1
Sequence:CCGGCCAAGCTTATGTCTACCTGAACTCGAGTTCAGGTAGACATAAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152317.1-474s1c1
Sequence:CCGGCTACAGGTTTCTAGGCAATAACTCGAGTTATTGCCTAGAAACCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152317.1-826s1c1
Sequence:CCGGGTTATCACTAACACTTGCCTACTCGAGTAGGCAAGTGTTAGTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152317.1-70s1c1
Sequence:CCGGCTTGTCAGTCAGAACGAGCTTCTCGAGAAGCTCGTTCTGACTGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152317.1-1100s1c1
Sequence:CCGGGCAGAACAACTGGTCTGGTTTCTCGAGAAACCAGACCAGTTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152317.2-645s21c1
Sequence:CCGGTCCAGCTTTATGTCCAAATATCTCGAGATATTTGGACATAAAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152317.2-728s21c1
Sequence:CCGGTATGTCTTCTTCAATTGATTCCTCGAGGAATCAATTGAAGAAGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152317.2-817s21c1
Sequence:CCGGGAAGATCTTGTTATCACTAACCTCGAGGTTAGTGATAACAAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152317.2-955s21c1
Sequence:CCGGAGAATTACGACGGCTACTTACCTCGAGGTAAGTAGCCGTCGTAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152317
DEPDC4 MISSION shRNA shRNA Plasmid DNA
DEP domain containing 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152317.1-1635s1c1
Sequence:CCGGCCTGACTGACTGTAACCTCAACTCGAGTTGAGGTTACAGTCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152317.1-173s1c1
Sequence:CCGGCCTTTCAAGCTACTCAGCTATCTCGAGATAGCTGAGTAGCTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152317.1-862s1c1
Sequence:CCGGCCAAGCTTATGTCTACCTGAACTCGAGTTCAGGTAGACATAAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152317.1-474s1c1
Sequence:CCGGCTACAGGTTTCTAGGCAATAACTCGAGTTATTGCCTAGAAACCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152317.1-826s1c1
Sequence:CCGGGTTATCACTAACACTTGCCTACTCGAGTAGGCAAGTGTTAGTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152317.1-70s1c1
Sequence:CCGGCTTGTCAGTCAGAACGAGCTTCTCGAGAAGCTCGTTCTGACTGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152317.1-1100s1c1
Sequence:CCGGGCAGAACAACTGGTCTGGTTTCTCGAGAAACCAGACCAGTTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152317.2-645s21c1
Sequence:CCGGTCCAGCTTTATGTCCAAATATCTCGAGATATTTGGACATAAAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152317.2-728s21c1
Sequence:CCGGTATGTCTTCTTCAATTGATTCCTCGAGGAATCAATTGAAGAAGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152317.2-817s21c1
Sequence:CCGGGAAGATCTTGTTATCACTAACCTCGAGGTTAGTGATAACAAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152317.2-955s21c1
Sequence:CCGGAGAATTACGACGGCTACTTACCTCGAGGTAAGTAGCCGTCGTAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152317
DEPDC4 MISSION shRNA Lentiviral Transduction Particles
DEP domain containing 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152317.1-1635s1c1
Sequence:CCGGCCTGACTGACTGTAACCTCAACTCGAGTTGAGGTTACAGTCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152317.1-173s1c1
Sequence:CCGGCCTTTCAAGCTACTCAGCTATCTCGAGATAGCTGAGTAGCTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152317.1-862s1c1
Sequence:CCGGCCAAGCTTATGTCTACCTGAACTCGAGTTCAGGTAGACATAAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152317.1-474s1c1
Sequence:CCGGCTACAGGTTTCTAGGCAATAACTCGAGTTATTGCCTAGAAACCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152317.1-826s1c1
Sequence:CCGGGTTATCACTAACACTTGCCTACTCGAGTAGGCAAGTGTTAGTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152317.1-70s1c1
Sequence:CCGGCTTGTCAGTCAGAACGAGCTTCTCGAGAAGCTCGTTCTGACTGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152317.1-1100s1c1
Sequence:CCGGGCAGAACAACTGGTCTGGTTTCTCGAGAAACCAGACCAGTTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152317.2-645s21c1
Sequence:CCGGTCCAGCTTTATGTCCAAATATCTCGAGATATTTGGACATAAAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152317.2-728s21c1
Sequence:CCGGTATGTCTTCTTCAATTGATTCCTCGAGGAATCAATTGAAGAAGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152317.2-817s21c1
Sequence:CCGGGAAGATCTTGTTATCACTAACCTCGAGGTTAGTGATAACAAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152317.2-955s21c1
Sequence:CCGGAGAATTACGACGGCTACTTACCTCGAGGTAAGTAGCCGTCGTAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks