EMAIL THIS PAGE TO A FRIEND

DEPDC5

DEP domain containing 5

104 Gene Product Result for
Synonyms: DEP.5 FFEVF
Gene ID:
Mouse(277854) DEP domain containing 5
Rat(305464) DEP domain containing 5
Zebrafish(562995) DEP domain containing 5
chicken(416956) DEP domain containing 5
dog(477546) DEP domain containing 5
domestic cat(101099661) DEP domain containing 5
Horse(100058243) DEP domain containing 5
domestic guinea pig(100728656) DEP domain containing 5
sheep(101104430) DEP domain containing 5
Domestic Rabbit(100328733) DEP domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014662 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007188 Rosetta Predictions human pricing
NM_014662 Rosetta Predictions human pricing
NM_001107229 Rosetta Predictions rat pricing
NM_001025426 Rosetta Predictions mouse pricing
NM_177786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185769 predicted 304
2 SASI_Hs01_00185770 predicted 1455
3 SASI_Hs01_00185771 predicted 310
4 SASI_Hs01_00185772 predicted 1523
5 SASI_Hs02_00305246 predicted 725
6 SASI_Hs01_00185774 predicted 1305
7 SASI_Hs01_00185775 predicted 1222
8 SASI_Hs01_00185776 predicted 1413
9 SASI_Hs02_00305247 predicted 770
10 SASI_Hs01_00185777 predicted 563
11 SASI_Hs01_00185773 predicted 1270
12 SASI_Hs01_00185778 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179718 predicted 303
2 SASI_Hs01_00179719 predicted 1450
3 SASI_Hs01_00179720 predicted 302
4 SASI_Hs01_00179721 predicted 1521
5 SASI_Hs02_00346004 predicted 724
6 SASI_Hs01_00179723 predicted 1302
7 SASI_Hs01_00179724 predicted 1220
8 SASI_Hs01_00179725 predicted 1417
9 SASI_Hs02_00346005 predicted 773
10 SASI_Hs01_00179726 predicted 560
11 SASI_Hs01_00179722 predicted 1276
12 SASI_Hs01_00179727 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226785 predicted 2267
2 SASI_Rn02_00226786 predicted 2534
3 SASI_Rn02_00226787 predicted 3135
4 SASI_Rn02_00226788 predicted 4308
5 SASI_Rn02_00226789 predicted 2179
6 SASI_Rn02_00226790 predicted 3045
7 SASI_Rn02_00226791 predicted 4257
8 SASI_Rn02_00226792 predicted 2751
9 SASI_Rn02_00226793 predicted 2724
10 SASI_Rn02_00226794 predicted 3280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047195 predicted 2886
2 SASI_Mm01_00047196 predicted 688
3 SASI_Mm01_00047197 predicted 1927
4 SASI_Mm01_00047198 predicted 1599
5 SASI_Mm01_00047199 predicted 1377
6 SASI_Mm01_00047200 predicted 700
7 SASI_Mm01_00047201 predicted 1744
8 SASI_Mm01_00047202 predicted 1775
9 SASI_Mm01_00047203 predicted 1531
10 SASI_Mm01_00047204 predicted 3101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158149 predicted 2506
2 SASI_Mm01_00158150 predicted 331
3 SASI_Mm01_00158151 predicted 1564
4 SASI_Mm01_00158152 predicted 1237
5 SASI_Mm01_00158153 predicted 1014
6 SASI_Mm01_00158154 predicted 344
7 SASI_Mm01_00158155 predicted 1389
8 SASI_Mm01_00158156 predicted 1424
9 SASI_Mm01_00158157 predicted 1170
10 SASI_Mm01_00158158 predicted 2720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014662
DEPDC5 MISSION shRNA Bacterial Glycerol Stock
DEP domain containing 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-3796s1c1
Sequence:CCGGGACCTTCATCTACGGCTTCTACTCGAGTAGAAGCCGTAGATGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-4287s1c1
Sequence:CCGGGCTTCTTGTTAGTCCCAGTTTCTCGAGAAACTGGGACTAACAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-1274s1c1
Sequence:CCGGCCATTGTTCAAGCTCCATAATCTCGAGATTATGGAGCTTGAACAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-429s1c1
Sequence:CCGGCCCTTGACCTAGTGGAATTAACTCGAGTTAATTCCACTAGGTCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-2548s1c1
Sequence:CCGGCCAAATCATAGTGCAGCCCAACTCGAGTTGGGCTGCACTATGATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014662.2-5221s1c1
Sequence:CCGGCCTTCACCATCTATGGGATATCTCGAGATATCCCATAGATGGTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014662
DEPDC5 MISSION shRNA shRNA Plasmid DNA
DEP domain containing 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-3796s1c1
Sequence:CCGGGACCTTCATCTACGGCTTCTACTCGAGTAGAAGCCGTAGATGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-4287s1c1
Sequence:CCGGGCTTCTTGTTAGTCCCAGTTTCTCGAGAAACTGGGACTAACAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-1274s1c1
Sequence:CCGGCCATTGTTCAAGCTCCATAATCTCGAGATTATGGAGCTTGAACAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-429s1c1
Sequence:CCGGCCCTTGACCTAGTGGAATTAACTCGAGTTAATTCCACTAGGTCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-2548s1c1
Sequence:CCGGCCAAATCATAGTGCAGCCCAACTCGAGTTGGGCTGCACTATGATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014662.2-5221s1c1
Sequence:CCGGCCTTCACCATCTATGGGATATCTCGAGATATCCCATAGATGGTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014662
DEPDC5 MISSION shRNA Lentiviral Transduction Particles
DEP domain containing 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-3796s1c1
Sequence:CCGGGACCTTCATCTACGGCTTCTACTCGAGTAGAAGCCGTAGATGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-4287s1c1
Sequence:CCGGGCTTCTTGTTAGTCCCAGTTTCTCGAGAAACTGGGACTAACAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-1274s1c1
Sequence:CCGGCCATTGTTCAAGCTCCATAATCTCGAGATTATGGAGCTTGAACAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-429s1c1
Sequence:CCGGCCCTTGACCTAGTGGAATTAACTCGAGTTAATTCCACTAGGTCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014662.2-2548s1c1
Sequence:CCGGCCAAATCATAGTGCAGCCCAACTCGAGTTGGGCTGCACTATGATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014662.2-5221s1c1
Sequence:CCGGCCTTCACCATCTATGGGATATCTCGAGATATCCCATAGATGGTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025426
DEPDC5 MISSION shRNA Bacterial Glycerol Stock
DEP domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025426.1-4825s1c1
Sequence:CCGGCCTGTTCGATAGTTTGGATTTCTCGAGAAATCCAAACTATCGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025426.1-1600s1c1
Sequence:CCGGGCCATTATTCAAGCTACATAACTCGAGTTATGTAGCTTGAATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025426.1-547s1c1
Sequence:CCGGCCCTAAAGTATTTCCTCACATCTCGAGATGTGAGGAAATACTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025426.1-3205s1c1
Sequence:CCGGCGAGGAATACAAGTGGAATTACTCGAGTAATTCCACTTGTATTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025426.1-5385s1c1
Sequence:CCGGCGCCAACCAAATCTTGCCAATCTCGAGATTGGCAAGATTTGGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025426
DEPDC5 MISSION shRNA shRNA Plasmid DNA
DEP domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025426.1-4825s1c1
Sequence:CCGGCCTGTTCGATAGTTTGGATTTCTCGAGAAATCCAAACTATCGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025426.1-1600s1c1
Sequence:CCGGGCCATTATTCAAGCTACATAACTCGAGTTATGTAGCTTGAATAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025426.1-547s1c1
Sequence:CCGGCCCTAAAGTATTTCCTCACATCTCGAGATGTGAGGAAATACTTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025426.1-3205s1c1
Sequence:CCGGCGAGGAATACAAGTGGAATTACTCGAGTAATTCCACTTGTATTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025426.1-5385s1c1
Sequence:CCGGCGCCAACCAAATCTTGCCAATCTCGAGATTGGCAAGATTTGGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025426
DEPDC5 MISSION shRNA Lentiviral Transduction Particles
DEP domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025426.1-4825s1c1
Sequence:CCGGCCTGTTCGATAGTTTGGATTTCTCGAGAAATCCAAACTATCGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025426.1-1600s1c1
Sequence:CCGGGCCATTATTCAAGCTACATAACTCGAGTTATGTAGCTTGAATAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025426.1-547s1c1
Sequence:CCGGCCCTAAAGTATTTCCTCACATCTCGAGATGTGAGGAAATACTTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025426.1-3205s1c1
Sequence:CCGGCGAGGAATACAAGTGGAATTACTCGAGTAATTCCACTTGTATTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025426.1-5385s1c1
Sequence:CCGGCGCCAACCAAATCTTGCCAATCTCGAGATTGGCAAGATTTGGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)