EMAIL THIS PAGE TO A FRIEND

DEPDC7

DEP domain containing 7

Synonyms: TR2 dJ85M6.4
UniProtKB ID: Q96QD5, G5E941, Q8N602, Q8NCU9, Q9UGK5
Gene ID:
Mouse(211896) DEP domain containing 7
Rat(295971) DEP domain containing 7
Zebrafish(692297) DEP domain containing 7
chicken(421593) DEP domain containing 7
domestic cat(101089462) DEP domain containing 7
cow(532586) DEP domain containing 7
dog(483435) DEP domain containing 7
sheep(101113098) DEP domain containing 7
domestic guinea pig(100734499) DEP domain containing 7
naked mole-rat(101714996) DEP domain containing 7
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139160 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077242 Rosetta Predictions human pricing
NM_139160 Rosetta Predictions human pricing
NM_001029916 Rosetta Predictions rat pricing
NM_144804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312284 predicted 1153
2 SASI_Hs02_00312285 predicted 524
3 SASI_Hs02_00312286 predicted 893
4 SASI_Hs02_00312287 predicted 594
5 SASI_Hs02_00312288 predicted 668
6 SASI_Hs02_00312289 predicted 1428
7 SASI_Hs02_00312290 predicted 846
8 SASI_Hs02_00312291 predicted 1488
9 SASI_Hs02_00312292 predicted 893
10 SASI_Hs02_00312293 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202677 predicted 1398
2 SASI_Hs02_00364168 predicted 761
3 SASI_Hs02_00364169 predicted 1136
4 SASI_Hs01_00202679 predicted 836
5 SASI_Hs02_00364170 predicted 904
6 SASI_Hs02_00364171 predicted 1672
7 SASI_Hs01_00202680 predicted 1082
8 SASI_Hs01_00202681 predicted 1724
9 SASI_Hs02_00364172 predicted 1127
10 SASI_Hs01_00202683 predicted 1159
11 SASI_Hs01_00202678 predicted 421
12 SASI_Hs01_00202682 predicted 456
13 SASI_Hs01_00202684 predicted 1438
14 SASI_Hs01_00202685 predicted 1137
15 SASI_Hs01_00202686 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101484 predicted 947
2 SASI_Rn02_00203482 predicted 374
3 SASI_Rn01_00101486 predicted 540
4 SASI_Rn01_00101487 predicted 237
5 SASI_Rn01_00101488 predicted 1445
6 SASI_Rn01_00101489 predicted 1398
7 SASI_Rn01_00101490 predicted 350
8 SASI_Rn01_00101491 predicted 841
9 SASI_Rn01_00101492 predicted 1181
10 SASI_Rn01_00101493 predicted 457
11 SASI_Rn01_00101485 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039008 predicted 1475
2 SASI_Mm01_00039009 predicted 264
3 SASI_Mm01_00039011 predicted 936
4 SASI_Mm01_00039012 predicted 521
5 SASI_Mm01_00039013 predicted 1179
6 SASI_Mm02_00340154 predicted 658
7 SASI_Mm01_00039014 predicted 996
8 SASI_Mm01_00039015 predicted 957
9 SASI_Mm01_00039016 predicted 1453
10 SASI_Mm01_00039017 predicted 396
11 SASI_Mm01_00039010 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139160
VALIDATED
DEPDC7 MISSION shRNA Bacterial Glycerol Stock
DEP domain containing 7
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_139160.1-436s1c1
Sequence:CCGGCACGTATGTATGGAGCAGCATCTCGAGATGCTGCTCCATACATACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139160.1-1700s1c1
Sequence:CCGGCAACGTGACTATTCCAACAATCTCGAGATTGTTGGAATAGTCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_139160.1-1412s1c1
Sequence:CCGGCTACTGTATTTCATGGCTGTTCTCGAGAACAGCCATGAAATACAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139160.1-1338s1c1
Sequence:CCGGCGGAAATAGCTTTAGAAGCTACTCGAGTAGCTTCTAAAGCTATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139160.1-743s1c1
Sequence:CCGGCCTAACCAAGACAGTCAGTTACTCGAGTAACTGACTGTCTTGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139160.1-374s1c1
Sequence:CCGGGAGTTCTACTGGCAGGAATTTCTCGAGAAATTCCTGCCAGTAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_139160.1-1208s1c1
Sequence:CCGGGACCGAACAGACTTAGTGAAACTCGAGTTTCACTAAGTCTGTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139160.1-944s1c1
Sequence:CCGGGAAGAAACAATTGGGCGTCTACTCGAGTAGACGCCCAATTGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139160.1-1472s1c1
Sequence:CCGGGACAACCGAATGGTTGTGAAACTCGAGTTTCACAACCATTCGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-619s21c1
Sequence:CCGGGAGAGTGTGTCAAGCGCTTATCTCGAGATAAGCGCTTGACACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-1326s21c1
Sequence:CCGGTGAATGGGAAGACGGAAATAGCTCGAGCTATTTCCGTCTTCCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-1412s21c1
Sequence:CCGGCTACTGTATTTCATGGCTGTTCTCGAGAACAGCCATGAAATACAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-1240s21c1
Sequence:CCGGTGATGCCATTGGCAGATATTACTCGAGTAATATCTGCCAATGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-1286s21c1
Sequence:CCGGCACTTATCTGACGTTCATAATCTCGAGATTATGAACGTCAGATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139160
VALIDATED
DEPDC7 MISSION shRNA shRNA Plasmid DNA
DEP domain containing 7
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_139160.1-436s1c1
Sequence:CCGGCACGTATGTATGGAGCAGCATCTCGAGATGCTGCTCCATACATACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139160.1-1700s1c1
Sequence:CCGGCAACGTGACTATTCCAACAATCTCGAGATTGTTGGAATAGTCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_139160.1-1412s1c1
Sequence:CCGGCTACTGTATTTCATGGCTGTTCTCGAGAACAGCCATGAAATACAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139160.1-1338s1c1
Sequence:CCGGCGGAAATAGCTTTAGAAGCTACTCGAGTAGCTTCTAAAGCTATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139160.1-743s1c1
Sequence:CCGGCCTAACCAAGACAGTCAGTTACTCGAGTAACTGACTGTCTTGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139160.1-374s1c1
Sequence:CCGGGAGTTCTACTGGCAGGAATTTCTCGAGAAATTCCTGCCAGTAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_139160.1-1208s1c1
Sequence:CCGGGACCGAACAGACTTAGTGAAACTCGAGTTTCACTAAGTCTGTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139160.1-944s1c1
Sequence:CCGGGAAGAAACAATTGGGCGTCTACTCGAGTAGACGCCCAATTGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139160.1-1472s1c1
Sequence:CCGGGACAACCGAATGGTTGTGAAACTCGAGTTTCACAACCATTCGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-619s21c1
Sequence:CCGGGAGAGTGTGTCAAGCGCTTATCTCGAGATAAGCGCTTGACACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-1326s21c1
Sequence:CCGGTGAATGGGAAGACGGAAATAGCTCGAGCTATTTCCGTCTTCCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-1412s21c1
Sequence:CCGGCTACTGTATTTCATGGCTGTTCTCGAGAACAGCCATGAAATACAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-1240s21c1
Sequence:CCGGTGATGCCATTGGCAGATATTACTCGAGTAATATCTGCCAATGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-1286s21c1
Sequence:CCGGCACTTATCTGACGTTCATAATCTCGAGATTATGAACGTCAGATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139160
VALIDATED
DEPDC7 MISSION shRNA Lentiviral Transduction Particles
DEP domain containing 7
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_139160.1-436s1c1
Sequence:CCGGCACGTATGTATGGAGCAGCATCTCGAGATGCTGCTCCATACATACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139160.1-1700s1c1
Sequence:CCGGCAACGTGACTATTCCAACAATCTCGAGATTGTTGGAATAGTCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_139160.1-1412s1c1
Sequence:CCGGCTACTGTATTTCATGGCTGTTCTCGAGAACAGCCATGAAATACAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139160.1-1338s1c1
Sequence:CCGGCGGAAATAGCTTTAGAAGCTACTCGAGTAGCTTCTAAAGCTATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139160.1-743s1c1
Sequence:CCGGCCTAACCAAGACAGTCAGTTACTCGAGTAACTGACTGTCTTGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139160.1-374s1c1
Sequence:CCGGGAGTTCTACTGGCAGGAATTTCTCGAGAAATTCCTGCCAGTAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_139160.1-1208s1c1
Sequence:CCGGGACCGAACAGACTTAGTGAAACTCGAGTTTCACTAAGTCTGTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139160.1-944s1c1
Sequence:CCGGGAAGAAACAATTGGGCGTCTACTCGAGTAGACGCCCAATTGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139160.1-1472s1c1
Sequence:CCGGGACAACCGAATGGTTGTGAAACTCGAGTTTCACAACCATTCGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-619s21c1
Sequence:CCGGGAGAGTGTGTCAAGCGCTTATCTCGAGATAAGCGCTTGACACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-1326s21c1
Sequence:CCGGTGAATGGGAAGACGGAAATAGCTCGAGCTATTTCCGTCTTCCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-1412s21c1
Sequence:CCGGCTACTGTATTTCATGGCTGTTCTCGAGAACAGCCATGAAATACAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-1240s21c1
Sequence:CCGGTGATGCCATTGGCAGATATTACTCGAGTAATATCTGCCAATGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139160.2-1286s21c1
Sequence:CCGGCACTTATCTGACGTTCATAATCTCGAGATTATGAACGTCAGATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144804
DEPDC7 MISSION shRNA Bacterial Glycerol Stock
DEP domain containing 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144804.1-1275s1c1
Sequence:CCGGCTCTTCTTAATGGATCACCAACTCGAGTTGGTGATCCATTAAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144804.1-522s1c1
Sequence:CCGGGCATCGTTTATGTCATCTGATCTCGAGATCAGATGACATAAACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144804.1-1390s1c1
Sequence:CCGGGCTATATTTATTGCCAGAGAACTCGAGTTCTCTGGCAATAAATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144804.1-433s1c1
Sequence:CCGGGCAGCCTTTATAGATTCACAACTCGAGTTGTGAATCTATAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-206s21c1
Sequence:CCGGGAAGCGAAGGCACCACTTAAACTCGAGTTTAAGTGGTGCCTTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-881s21c1
Sequence:CCGGCCAGATGGTTGTGGATATAAGCTCGAGCTTATATCCACAACCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-1457s21c1
Sequence:CCGGTCAACTGTTGAGCTTACTAAACTCGAGTTTAGTAAGCTCAACAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-1150s21c1
Sequence:CCGGCAGCAGATCCTTCGGAATTTACTCGAGTAAATTCCGAAGGATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-956s21c1
Sequence:CCGGTGACGCTATTGGCAGATATTACTCGAGTAATATCTGCCAATAGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144804
DEPDC7 MISSION shRNA shRNA Plasmid DNA
DEP domain containing 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144804.1-1275s1c1
Sequence:CCGGCTCTTCTTAATGGATCACCAACTCGAGTTGGTGATCCATTAAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144804.1-522s1c1
Sequence:CCGGGCATCGTTTATGTCATCTGATCTCGAGATCAGATGACATAAACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144804.1-1390s1c1
Sequence:CCGGGCTATATTTATTGCCAGAGAACTCGAGTTCTCTGGCAATAAATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144804.1-433s1c1
Sequence:CCGGGCAGCCTTTATAGATTCACAACTCGAGTTGTGAATCTATAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-206s21c1
Sequence:CCGGGAAGCGAAGGCACCACTTAAACTCGAGTTTAAGTGGTGCCTTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-881s21c1
Sequence:CCGGCCAGATGGTTGTGGATATAAGCTCGAGCTTATATCCACAACCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-1457s21c1
Sequence:CCGGTCAACTGTTGAGCTTACTAAACTCGAGTTTAGTAAGCTCAACAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-1150s21c1
Sequence:CCGGCAGCAGATCCTTCGGAATTTACTCGAGTAAATTCCGAAGGATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-956s21c1
Sequence:CCGGTGACGCTATTGGCAGATATTACTCGAGTAATATCTGCCAATAGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144804
DEPDC7 MISSION shRNA Lentiviral Transduction Particles
DEP domain containing 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144804.1-1275s1c1
Sequence:CCGGCTCTTCTTAATGGATCACCAACTCGAGTTGGTGATCCATTAAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144804.1-522s1c1
Sequence:CCGGGCATCGTTTATGTCATCTGATCTCGAGATCAGATGACATAAACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144804.1-1390s1c1
Sequence:CCGGGCTATATTTATTGCCAGAGAACTCGAGTTCTCTGGCAATAAATATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144804.1-433s1c1
Sequence:CCGGGCAGCCTTTATAGATTCACAACTCGAGTTGTGAATCTATAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-206s21c1
Sequence:CCGGGAAGCGAAGGCACCACTTAAACTCGAGTTTAAGTGGTGCCTTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-881s21c1
Sequence:CCGGCCAGATGGTTGTGGATATAAGCTCGAGCTTATATCCACAACCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-1457s21c1
Sequence:CCGGTCAACTGTTGAGCTTACTAAACTCGAGTTTAGTAAGCTCAACAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-1150s21c1
Sequence:CCGGCAGCAGATCCTTCGGAATTTACTCGAGTAAATTCCGAAGGATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144804.1-956s21c1
Sequence:CCGGTGACGCTATTGGCAGATATTACTCGAGTAATATCTGCCAATAGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks