EMAIL THIS PAGE TO A FRIEND

DEPTOR

DEP domain containing MTOR-interacting protein

129 Gene Product Result for
Synonyms: DEP.6 DEPDC6
UniProtKB ID: Q8TB45, B2RCL9, Q96EQ1, Q9H0R7, Q9H894, Q9HA07
Gene ID:
Mouse(97998) DEP domain containing MTOR-interacting protein
Rat(314979) DEP domain containing MTOR-interacting protein
Zebrafish(768177) DEP domain containing MTOR-interacting protein
chicken(419242) DEP domain containing MTOR-interacting protein
domestic cat(101098686) DEP domain containing MTOR-interacting protein
cow(617606) DEP domain containing MTOR-interacting protein
Horse(100057185) DEP domain containing MTOR-interacting protein
dog(482028) DEP domain containing MTOR-interacting protein
sheep(101116663) DEP domain containing MTOR-interacting protein
Domestic Rabbit(100353512) DEP domain containing MTOR-interacting protein
naked mole-rat(101721484) DEP domain containing MTOR-interacting protein
domestic guinea pig(100721956) DEP domain containing MTOR-interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022783 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022783 Rosetta Predictions human pricing
XM_001066889 Rosetta Predictions rat pricing
XM_235306 Rosetta Predictions rat pricing
NM_001037937 Rosetta Predictions mouse pricing
NM_145470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204341 predicted 416
2 SASI_Hs02_00356082 predicted 1218
3 SASI_Hs01_00204343 predicted 326
4 SASI_Hs01_00204344 predicted 689
5 SASI_Hs02_00356083 predicted 1468
6 SASI_Hs01_00204345 predicted 1416
7 SASI_Hs01_00204346 predicted 1506
8 SASI_Hs01_00204347 predicted 504
9 SASI_Hs01_00204349 predicted 1397
10 SASI_Hs01_00204350 predicted 682
11 SASI_Hs01_00204342 predicted 371
12 SASI_Hs01_00204348 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319079 predicted 1282
2 SASI_Rn02_00319080 predicted 1421
3 SASI_Rn02_00319081 predicted 360
4 SASI_Rn02_00319082 predicted 1176
5 SASI_Rn02_00319083 predicted 666
6 SASI_Rn02_00319084 predicted 1480
7 SASI_Rn02_00319085 predicted 1268
8 SASI_Rn02_00319086 predicted 1281
9 SASI_Rn02_00319087 predicted 1174
10 SASI_Rn02_00319088 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159640 predicted 613
2 SASI_Rn01_00159641 predicted 262
3 SASI_Rn01_00159642 predicted 383
4 SASI_Rn01_00159643 predicted 327
5 SASI_Rn01_00159644 predicted 353
6 SASI_Rn01_00159645 predicted 547
7 SASI_Rn01_00159646 predicted 611
8 SASI_Rn01_00159647 predicted 423
9 SASI_Rn01_00159648 predicted 387
10 SASI_Rn01_00159649 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289538 predicted 1091
2 SASI_Mm02_00289539 predicted 993
3 SASI_Mm01_00149666 predicted 573
4 SASI_Mm01_00149668 predicted 332
5 SASI_Mm02_00289540 predicted 926
6 SASI_Mm02_00289541 predicted 424
7 SASI_Mm02_00289542 predicted 992
8 SASI_Mm01_00149671 predicted 1298
9 SASI_Mm02_00289543 predicted 759
10 SASI_Mm02_00289544 predicted 991
11 SASI_Mm01_00149663 predicted 497
12 SASI_Mm01_00149664 predicted 726
13 SASI_Mm01_00149665 predicted 641
14 SASI_Mm01_00149667 predicted 390
15 SASI_Mm01_00149669 predicted 712
16 SASI_Mm01_00149670 predicted 567
17 SASI_Mm01_00149672 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340866 predicted 1101
2 SASI_Mm02_00340867 predicted 1001
3 SASI_Mm01_00026488 predicted 583
4 SASI_Mm01_00026490 predicted 344
5 SASI_Mm02_00340868 predicted 934
6 SASI_Mm02_00340869 predicted 441
7 SASI_Mm02_00340870 predicted 999
8 SASI_Mm01_00026493 predicted 1311
9 SASI_Mm02_00340871 predicted 777
10 SASI_Mm02_00340872 predicted 994
11 SASI_Mm01_00026485 predicted 501
12 SASI_Mm01_00026486 predicted 744
13 SASI_Mm01_00026487 predicted 653
14 SASI_Mm01_00026489 predicted 401
15 SASI_Mm01_00026491 predicted 725
16 SASI_Mm01_00026492 predicted 581
17 SASI_Mm01_00026494 predicted 1315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145470
VALIDATED
DEPTOR MISSION shRNA Bacterial Glycerol Stock
DEP domain containing MTOR-interacting protein
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145470.2-1375s21c1
Sequence:CCGGCGCTGTTTGAATGTGGAAGAACTCGAGTTCTTCCACATTCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-1629s21c1
Sequence:CCGGGTTTAGAGTTCTCAATCATTGCTCGAGCAATGATTGAGAACTCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-994s21c1
Sequence:CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-101s21c1
Sequence:CCGGGCATGGCTGAAGTCCTAGTTACTCGAGTAACTAGGACTTCAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-779s21c1
Sequence:CCGGGTCGGAAATCTACCAGCTTTACTCGAGTAAAGCTGGTAGATTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-255s21c1
Sequence:CCGGTGACCGAGAGACGGCGATAAACTCGAGTTTATCGCCGTCTCTCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-1545s1c1
Sequence:CCGGCGCTGTTTGAATGTGGAAGAACTCGAGTTCTTCCACATTCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-272s1c1
Sequence:CCGGGCATGGCTGAAGTCCTAGTTACTCGAGTAACTAGGACTTCAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-1164s1c1
Sequence:CCGGCGCAAGGAAGACATTCACGATCTCGAGATCGTGAATGTCTTCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-950s1c1
Sequence:CCGGGTCGGAAATCTACCAGCTTTACTCGAGTAAAGCTGGTAGATTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-1165s1c1
Sequence:CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145470
VALIDATED
DEPTOR MISSION shRNA shRNA Plasmid DNA
DEP domain containing MTOR-interacting protein
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145470.2-1375s21c1
Sequence:CCGGCGCTGTTTGAATGTGGAAGAACTCGAGTTCTTCCACATTCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-1629s21c1
Sequence:CCGGGTTTAGAGTTCTCAATCATTGCTCGAGCAATGATTGAGAACTCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-994s21c1
Sequence:CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-101s21c1
Sequence:CCGGGCATGGCTGAAGTCCTAGTTACTCGAGTAACTAGGACTTCAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-779s21c1
Sequence:CCGGGTCGGAAATCTACCAGCTTTACTCGAGTAAAGCTGGTAGATTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-255s21c1
Sequence:CCGGTGACCGAGAGACGGCGATAAACTCGAGTTTATCGCCGTCTCTCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-1545s1c1
Sequence:CCGGCGCTGTTTGAATGTGGAAGAACTCGAGTTCTTCCACATTCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-272s1c1
Sequence:CCGGGCATGGCTGAAGTCCTAGTTACTCGAGTAACTAGGACTTCAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-1164s1c1
Sequence:CCGGCGCAAGGAAGACATTCACGATCTCGAGATCGTGAATGTCTTCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-950s1c1
Sequence:CCGGGTCGGAAATCTACCAGCTTTACTCGAGTAAAGCTGGTAGATTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-1165s1c1
Sequence:CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145470
VALIDATED
DEPTOR MISSION shRNA Lentiviral Transduction Particles
DEP domain containing MTOR-interacting protein
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145470.2-1375s21c1
Sequence:CCGGCGCTGTTTGAATGTGGAAGAACTCGAGTTCTTCCACATTCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-1629s21c1
Sequence:CCGGGTTTAGAGTTCTCAATCATTGCTCGAGCAATGATTGAGAACTCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-994s21c1
Sequence:CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-101s21c1
Sequence:CCGGGCATGGCTGAAGTCCTAGTTACTCGAGTAACTAGGACTTCAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-779s21c1
Sequence:CCGGGTCGGAAATCTACCAGCTTTACTCGAGTAAAGCTGGTAGATTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145470.2-255s21c1
Sequence:CCGGTGACCGAGAGACGGCGATAAACTCGAGTTTATCGCCGTCTCTCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-1545s1c1
Sequence:CCGGCGCTGTTTGAATGTGGAAGAACTCGAGTTCTTCCACATTCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-272s1c1
Sequence:CCGGGCATGGCTGAAGTCCTAGTTACTCGAGTAACTAGGACTTCAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-1164s1c1
Sequence:CCGGCGCAAGGAAGACATTCACGATCTCGAGATCGTGAATGTCTTCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-950s1c1
Sequence:CCGGGTCGGAAATCTACCAGCTTTACTCGAGTAAAGCTGGTAGATTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145470.1-1165s1c1
Sequence:CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022783
VALIDATED
DEPTOR MISSION shRNA Bacterial Glycerol Stock
DEP domain containing MTOR-interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_022783.2-519s21c1
Sequence:CCGGTCAAACTCTTCTACCGCTTTACTCGAGTAAAGCGGTAGAAGAGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022783.2-426s21c1
Sequence:CCGGCTGACAGAGAGACGGCAATTACTCGAGTAATTGCCGTCTCTCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022783.2-792s21c1
Sequence:CCGGTGTCCAACAAGCACCCATTTGCTCGAGCAAATGGGTGCTTGTTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022783.2-1775s21c1
Sequence:CCGGAGTCAATAGAGTAGTTGTTAACTCGAGTTAACAACTACTCTATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_022783.2-588s21c1
Sequence:CCGGTGAGAGGACAGAGGCTATATGCTCGAGCATATAGCCTCTGTCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022783.1-610s1c1
Sequence:CCGGGCACCTTCATGGCATCTGAATCTCGAGATTCAGATGCCATGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022783.1-1101s1c1
Sequence:CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022783.1-877s1c1
Sequence:CCGGGCCATGACAATCGGAAATCTACTCGAGTAGATTTCCGATTGTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022783.1-1578s1c1
Sequence:CCGGCCTACATGATAGAACTGCCTTCTCGAGAAGGCAGTTCTATCATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022783
VALIDATED
DEPTOR MISSION shRNA shRNA Plasmid DNA
DEP domain containing MTOR-interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_022783.2-519s21c1
Sequence:CCGGTCAAACTCTTCTACCGCTTTACTCGAGTAAAGCGGTAGAAGAGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022783.2-426s21c1
Sequence:CCGGCTGACAGAGAGACGGCAATTACTCGAGTAATTGCCGTCTCTCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022783.2-792s21c1
Sequence:CCGGTGTCCAACAAGCACCCATTTGCTCGAGCAAATGGGTGCTTGTTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022783.2-1775s21c1
Sequence:CCGGAGTCAATAGAGTAGTTGTTAACTCGAGTTAACAACTACTCTATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_022783.2-588s21c1
Sequence:CCGGTGAGAGGACAGAGGCTATATGCTCGAGCATATAGCCTCTGTCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022783.1-610s1c1
Sequence:CCGGGCACCTTCATGGCATCTGAATCTCGAGATTCAGATGCCATGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022783.1-1101s1c1
Sequence:CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022783.1-877s1c1
Sequence:CCGGGCCATGACAATCGGAAATCTACTCGAGTAGATTTCCGATTGTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022783.1-1578s1c1
Sequence:CCGGCCTACATGATAGAACTGCCTTCTCGAGAAGGCAGTTCTATCATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022783
VALIDATED
DEPTOR MISSION shRNA Lentiviral Transduction Particles
DEP domain containing MTOR-interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_022783.2-519s21c1
Sequence:CCGGTCAAACTCTTCTACCGCTTTACTCGAGTAAAGCGGTAGAAGAGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022783.2-426s21c1
Sequence:CCGGCTGACAGAGAGACGGCAATTACTCGAGTAATTGCCGTCTCTCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022783.2-792s21c1
Sequence:CCGGTGTCCAACAAGCACCCATTTGCTCGAGCAAATGGGTGCTTGTTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022783.2-1775s21c1
Sequence:CCGGAGTCAATAGAGTAGTTGTTAACTCGAGTTAACAACTACTCTATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_022783.2-588s21c1
Sequence:CCGGTGAGAGGACAGAGGCTATATGCTCGAGCATATAGCCTCTGTCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022783.1-610s1c1
Sequence:CCGGGCACCTTCATGGCATCTGAATCTCGAGATTCAGATGCCATGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022783.1-1101s1c1
Sequence:CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022783.1-877s1c1
Sequence:CCGGGCCATGACAATCGGAAATCTACTCGAGTAGATTTCCGATTGTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022783.1-1578s1c1
Sequence:CCGGCCTACATGATAGAACTGCCTTCTCGAGAAGGCAGTTCTATCATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks