EMAIL THIS PAGE TO A FRIEND

DERA

deoxyribose-phosphate aldolase (putative)

42 Gene Product Result for
Synonyms: DEOC
UniProtKB ID: Q9Y315, Q53HN9, Q6PHW2
Gene ID:
Mouse(232449) 2-deoxyribose-5-phosphate aldolase homolog (C. elegans)
Rat(690945) deoxyribose-phosphate aldolase (putative)
Zebrafish(450077) 2-deoxyribose-5-phosphate aldolase homolog (C. elegans)
dog(477684) deoxyribose-phosphate aldolase (putative)
domestic cat(101099057) deoxyribose-phosphate aldolase (putative)
cow(534558) deoxyribose-phosphate aldolase (putative)
chicken(418176) deoxyribose-phosphate aldolase (putative)
domestic guinea pig(100715236) deoxyribose-phosphate aldolase (putative)
naked mole-rat(101714484) deoxyribose-phosphate aldolase (putative)
sheep(101103966) deoxyribose-phosphate aldolase (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015954 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015954 Rosetta Predictions human pricing
NM_172733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090357 predicted 580
2 SASI_Hs01_00090358 predicted 715
3 SASI_Hs01_00090359 predicted 326
4 SASI_Hs01_00090360 predicted 713
5 SASI_Hs01_00090362 predicted 528
6 SASI_Hs01_00090364 predicted 866
7 SASI_Hs01_00090365 predicted 832
8 SASI_Hs01_00090366 predicted 559
9 SASI_Hs02_00348593 predicted 581
10 SASI_Hs02_00348594 predicted 641
11 SASI_Hs01_00090361 predicted 260
12 SASI_Hs01_00090363 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048403 predicted 238
2 SASI_Mm01_00048404 predicted 471
3 SASI_Mm01_00048405 predicted 731
4 SASI_Mm01_00048406 predicted 483
5 SASI_Mm01_00048407 predicted 466
6 SASI_Mm01_00048408 predicted 476
7 SASI_Mm01_00048409 predicted 730
8 SASI_Mm01_00048410 predicted 322
9 SASI_Mm01_00048411 predicted 505
10 SASI_Mm01_00048412 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015954
VALIDATED
DERA MISSION shRNA Bacterial Glycerol Stock
deoxyribose-phosphate aldolase (putative)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-270s1c1
Sequence:CCGGCCAACATTCAAAGGCTCTGTTCTCGAGAACAGAGCCTTTGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-979s1c1
Sequence:CCGGCCATCATGTGACTGGAAGATACTCGAGTATCTTCCAGTCACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-524s1c1
Sequence:CCGGGCTACAGAAATCGACGTGGTACTCGAGTACCACGTCGATTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-283s1c1
Sequence:CCGGGCTCTGTTATAAAGCCAAATACTCGAGTATTTGGCTTTATAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-423s1c1
Sequence:CCGGGCTGTAATATCCCTGTGGCATCTCGAGATGCCACAGGGATATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015954.2-482s21c1
Sequence:CCGGGCTGTAATATCCCTGTGGCATCTCGAGATGCCACAGGGATATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015954.2-329s21c1
Sequence:CCGGCCAACATTCAAAGGCTCTGTTCTCGAGAACAGAGCCTTTGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015954.2-583s21c1
Sequence:CCGGGCTACAGAAATCGACGTGGTACTCGAGTACCACGTCGATTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015954.2-1038s21c1
Sequence:CCGGCCATCATGTGACTGGAAGATACTCGAGTATCTTCCAGTCACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015954.2-342s21c1
Sequence:CCGGGCTCTGTTATAAAGCCAAATACTCGAGTATTTGGCTTTATAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015954
VALIDATED
DERA MISSION shRNA shRNA Plasmid DNA
deoxyribose-phosphate aldolase (putative)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-270s1c1
Sequence:CCGGCCAACATTCAAAGGCTCTGTTCTCGAGAACAGAGCCTTTGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-979s1c1
Sequence:CCGGCCATCATGTGACTGGAAGATACTCGAGTATCTTCCAGTCACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-524s1c1
Sequence:CCGGGCTACAGAAATCGACGTGGTACTCGAGTACCACGTCGATTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-283s1c1
Sequence:CCGGGCTCTGTTATAAAGCCAAATACTCGAGTATTTGGCTTTATAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-423s1c1
Sequence:CCGGGCTGTAATATCCCTGTGGCATCTCGAGATGCCACAGGGATATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015954.2-482s21c1
Sequence:CCGGGCTGTAATATCCCTGTGGCATCTCGAGATGCCACAGGGATATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015954.2-329s21c1
Sequence:CCGGCCAACATTCAAAGGCTCTGTTCTCGAGAACAGAGCCTTTGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015954.2-583s21c1
Sequence:CCGGGCTACAGAAATCGACGTGGTACTCGAGTACCACGTCGATTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015954.2-1038s21c1
Sequence:CCGGCCATCATGTGACTGGAAGATACTCGAGTATCTTCCAGTCACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015954.2-342s21c1
Sequence:CCGGGCTCTGTTATAAAGCCAAATACTCGAGTATTTGGCTTTATAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015954
VALIDATED
DERA MISSION shRNA Lentiviral Transduction Particles
deoxyribose-phosphate aldolase (putative)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-270s1c1
Sequence:CCGGCCAACATTCAAAGGCTCTGTTCTCGAGAACAGAGCCTTTGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-979s1c1
Sequence:CCGGCCATCATGTGACTGGAAGATACTCGAGTATCTTCCAGTCACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-524s1c1
Sequence:CCGGGCTACAGAAATCGACGTGGTACTCGAGTACCACGTCGATTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-283s1c1
Sequence:CCGGGCTCTGTTATAAAGCCAAATACTCGAGTATTTGGCTTTATAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015954.1-423s1c1
Sequence:CCGGGCTGTAATATCCCTGTGGCATCTCGAGATGCCACAGGGATATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015954.2-482s21c1
Sequence:CCGGGCTGTAATATCCCTGTGGCATCTCGAGATGCCACAGGGATATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015954.2-329s21c1
Sequence:CCGGCCAACATTCAAAGGCTCTGTTCTCGAGAACAGAGCCTTTGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015954.2-583s21c1
Sequence:CCGGGCTACAGAAATCGACGTGGTACTCGAGTACCACGTCGATTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015954.2-1038s21c1
Sequence:CCGGCCATCATGTGACTGGAAGATACTCGAGTATCTTCCAGTCACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015954.2-342s21c1
Sequence:CCGGGCTCTGTTATAAAGCCAAATACTCGAGTATTTGGCTTTATAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172733
DERA MISSION shRNA Bacterial Glycerol Stock
deoxyribose-phosphate aldolase (putative)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172733.1-496s1c1
Sequence:CCGGCGTGGTCATTAACAGGACCTTCTCGAGAAGGTCCTGTTAATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172733.1-914s1c1
Sequence:CCGGTCAGACATCGAGAGACAGATTCTCGAGAATCTGTCTCTCGATGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172733.1-429s1c1
Sequence:CCGGAGACTCATTTAAAGACTCGATCTCGAGATCGAGTCTTTAAATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172733.1-1467s1c1
Sequence:CCGGCCTACCTCTGACACATAATAACTCGAGTTATTATGTGTCAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172733.1-430s1c1
Sequence:CCGGGACTCATTTAAAGACTCGATTCTCGAGAATCGAGTCTTTAAATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172733.1-914s21c1
Sequence:CCGGTCAGACATCGAGAGACAGATTCTCGAGAATCTGTCTCTCGATGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172733.1-173s21c1
Sequence:CCGGCTGAAAGCTGTCACGTTTATACTCGAGTATAAACGTGACAGCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172733.1-317s21c1
Sequence:CCGGACAGCTGCAGTCTGCGTTTATCTCGAGATAAACGCAGACTGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172733.1-1467s21c1
Sequence:CCGGCCTACCTCTGACACATAATAACTCGAGTTATTATGTGTCAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172733.1-430s21c1
Sequence:CCGGGACTCATTTAAAGACTCGATTCTCGAGAATCGAGTCTTTAAATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172733
DERA MISSION shRNA shRNA Plasmid DNA
deoxyribose-phosphate aldolase (putative)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172733.1-496s1c1
Sequence:CCGGCGTGGTCATTAACAGGACCTTCTCGAGAAGGTCCTGTTAATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172733.1-914s1c1
Sequence:CCGGTCAGACATCGAGAGACAGATTCTCGAGAATCTGTCTCTCGATGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172733.1-429s1c1
Sequence:CCGGAGACTCATTTAAAGACTCGATCTCGAGATCGAGTCTTTAAATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172733.1-1467s1c1
Sequence:CCGGCCTACCTCTGACACATAATAACTCGAGTTATTATGTGTCAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172733.1-430s1c1
Sequence:CCGGGACTCATTTAAAGACTCGATTCTCGAGAATCGAGTCTTTAAATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172733.1-914s21c1
Sequence:CCGGTCAGACATCGAGAGACAGATTCTCGAGAATCTGTCTCTCGATGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172733.1-173s21c1
Sequence:CCGGCTGAAAGCTGTCACGTTTATACTCGAGTATAAACGTGACAGCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172733.1-317s21c1
Sequence:CCGGACAGCTGCAGTCTGCGTTTATCTCGAGATAAACGCAGACTGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172733.1-1467s21c1
Sequence:CCGGCCTACCTCTGACACATAATAACTCGAGTTATTATGTGTCAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172733.1-430s21c1
Sequence:CCGGGACTCATTTAAAGACTCGATTCTCGAGAATCGAGTCTTTAAATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172733
DERA MISSION shRNA Lentiviral Transduction Particles
deoxyribose-phosphate aldolase (putative)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172733.1-496s1c1
Sequence:CCGGCGTGGTCATTAACAGGACCTTCTCGAGAAGGTCCTGTTAATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172733.1-914s1c1
Sequence:CCGGTCAGACATCGAGAGACAGATTCTCGAGAATCTGTCTCTCGATGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172733.1-429s1c1
Sequence:CCGGAGACTCATTTAAAGACTCGATCTCGAGATCGAGTCTTTAAATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172733.1-1467s1c1
Sequence:CCGGCCTACCTCTGACACATAATAACTCGAGTTATTATGTGTCAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172733.1-430s1c1
Sequence:CCGGGACTCATTTAAAGACTCGATTCTCGAGAATCGAGTCTTTAAATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172733.1-914s21c1
Sequence:CCGGTCAGACATCGAGAGACAGATTCTCGAGAATCTGTCTCTCGATGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172733.1-173s21c1
Sequence:CCGGCTGAAAGCTGTCACGTTTATACTCGAGTATAAACGTGACAGCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172733.1-317s21c1
Sequence:CCGGACAGCTGCAGTCTGCGTTTATCTCGAGATAAACGCAGACTGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172733.1-1467s21c1
Sequence:CCGGCCTACCTCTGACACATAATAACTCGAGTTATTATGTGTCAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172733.1-430s21c1
Sequence:CCGGGACTCATTTAAAGACTCGATTCTCGAGAATCGAGTCTTTAAATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks