EMAIL THIS PAGE TO A FRIEND

DERL1

derlin 1

142 Gene Product Result for
Synonyms: DER-1 DER1
UniProtKB ID: Q9BUN8, B3KW41, E9PH19
Gene ID:
Human(79139) Summary: The protein encoded by this gene is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This protein recognizes substrate in the ER and works in a complex to retrotranslocate it across the ER membrane into the cytosol. This protein may select cystic fibrosis transmembrane conductance regulator protein (CFTR) for degradation as well as unfolded proteins in Alzheimer's disease. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Mouse(67819) Der1-like domain family, member 1
Rat(362912) derlin 1
Zebrafish(406753) Der1-like domain family, member 1
dog(475086) derlin 1
cow(404121) derlin 1
chicken(420350) derlin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024207 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024207 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024207 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024295 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024295 Rosetta Predictions human pricing
NM_001014202 Rosetta Predictions rat pricing
NM_024207 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107683 predicted 730
2 SASI_Hs01_00107684 predicted 622
3 SASI_Hs01_00107685 predicted 516
4 SASI_Hs01_00107686 predicted 543
5 SASI_Hs01_00107687 predicted 496
6 SASI_Hs01_00107688 predicted 631
7 SASI_Hs01_00107689 predicted 502
8 SASI_Hs01_00107690 predicted 485
9 SASI_Hs01_00107691 predicted 1009
10 SASI_Hs01_00107692 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081235 predicted 865
2 SASI_Rn02_00201726 predicted 622
3 SASI_Rn01_00081236 predicted 403
4 SASI_Rn01_00081237 predicted 266
5 SASI_Rn01_00081238 predicted 978
6 SASI_Rn01_00081239 predicted 490
7 SASI_Rn01_00081240 predicted 243
8 SASI_Rn01_00081241 predicted 261
9 SASI_Rn01_00081242 predicted 334
10 SASI_Rn01_00081243 predicted 388
11 SASI_Rn01_00081244 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135204 predicted 1053
2 SASI_Mm02_00327564 predicted 324
3 SASI_Mm01_00135205 predicted 1060
4 SASI_Mm01_00135207 predicted 476
5 SASI_Mm01_00135209 predicted 440
6 SASI_Mm01_00135210 predicted 492
7 SASI_Mm01_00135211 predicted 563
8 SASI_Mm01_00135212 predicted 580
9 SASI_Mm02_00327565 predicted 997
10 SASI_Mm01_00135213 predicted 1046
11 SASI_Mm01_00135206 predicted 347
12 SASI_Mm01_00135208 predicted 1080
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024207
VALIDATED
DERL1 MISSION shRNA Bacterial Glycerol Stock
derlin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024207.4-445s21c1
Sequence:CCGGTGCATCGTTATTACTGGCTTACTCGAGTAAGCCAGTAATAACGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024207.4-2075s21c1
Sequence:CCGGGCTCAGCTTATCACTAAATAACTCGAGTTATTTAGTGATAAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024207.4-409s21c1
Sequence:CCGGGCAGACTATTTATTCATGCTTCTCGAGAAGCATGAATAAATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024207.4-684s21c1
Sequence:CCGGGTTCAGATACCCAATGGACTTCTCGAGAAGTCCATTGGGTATCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024207.4-578s21c1
Sequence:CCGGCCTGTTACTTACCTTGGGTTACTCGAGTAACCCAAGGTAAGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-2076s1c1
Sequence:CCGGGCTCAGCTTATCACTAAATAACTCGAGTTATTTAGTGATAAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-579s1c1
Sequence:CCGGCCTGTTACTTACCTTGGGTTACTCGAGTAACCCAAGGTAAGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-410s1c1
Sequence:CCGGGCAGACTATTTATTCATGCTTCTCGAGAAGCATGAATAAATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-446s1c1
Sequence:CCGGTGCATCGTTATTACTGGCTTACTCGAGTAAGCCAGTAATAACGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-685s1c1
Sequence:CCGGGTTCAGATACCCAATGGACTTCTCGAGAAGTCCATTGGGTATCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024207
VALIDATED
DERL1 MISSION shRNA shRNA Plasmid DNA
derlin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024207.4-445s21c1
Sequence:CCGGTGCATCGTTATTACTGGCTTACTCGAGTAAGCCAGTAATAACGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024207.4-2075s21c1
Sequence:CCGGGCTCAGCTTATCACTAAATAACTCGAGTTATTTAGTGATAAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024207.4-409s21c1
Sequence:CCGGGCAGACTATTTATTCATGCTTCTCGAGAAGCATGAATAAATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024207.4-684s21c1
Sequence:CCGGGTTCAGATACCCAATGGACTTCTCGAGAAGTCCATTGGGTATCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024207.4-578s21c1
Sequence:CCGGCCTGTTACTTACCTTGGGTTACTCGAGTAACCCAAGGTAAGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-2076s1c1
Sequence:CCGGGCTCAGCTTATCACTAAATAACTCGAGTTATTTAGTGATAAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-579s1c1
Sequence:CCGGCCTGTTACTTACCTTGGGTTACTCGAGTAACCCAAGGTAAGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-410s1c1
Sequence:CCGGGCAGACTATTTATTCATGCTTCTCGAGAAGCATGAATAAATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-446s1c1
Sequence:CCGGTGCATCGTTATTACTGGCTTACTCGAGTAAGCCAGTAATAACGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-685s1c1
Sequence:CCGGGTTCAGATACCCAATGGACTTCTCGAGAAGTCCATTGGGTATCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024207
VALIDATED
DERL1 MISSION shRNA Lentiviral Transduction Particles
derlin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024207.4-445s21c1
Sequence:CCGGTGCATCGTTATTACTGGCTTACTCGAGTAAGCCAGTAATAACGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024207.4-2075s21c1
Sequence:CCGGGCTCAGCTTATCACTAAATAACTCGAGTTATTTAGTGATAAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024207.4-409s21c1
Sequence:CCGGGCAGACTATTTATTCATGCTTCTCGAGAAGCATGAATAAATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024207.4-684s21c1
Sequence:CCGGGTTCAGATACCCAATGGACTTCTCGAGAAGTCCATTGGGTATCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024207.4-578s21c1
Sequence:CCGGCCTGTTACTTACCTTGGGTTACTCGAGTAACCCAAGGTAAGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-2076s1c1
Sequence:CCGGGCTCAGCTTATCACTAAATAACTCGAGTTATTTAGTGATAAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-579s1c1
Sequence:CCGGCCTGTTACTTACCTTGGGTTACTCGAGTAACCCAAGGTAAGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-410s1c1
Sequence:CCGGGCAGACTATTTATTCATGCTTCTCGAGAAGCATGAATAAATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-446s1c1
Sequence:CCGGTGCATCGTTATTACTGGCTTACTCGAGTAAGCCAGTAATAACGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024207.2-685s1c1
Sequence:CCGGGTTCAGATACCCAATGGACTTCTCGAGAAGTCCATTGGGTATCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024295
VALIDATED
DERL1 MISSION shRNA Bacterial Glycerol Stock
derlin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024295.4-741s21c1
Sequence:CCGGCCTGCTATTTACCCTGGGTTACTCGAGTAACCCAGGGTAAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024295.4-841s21c1
Sequence:CCGGCCTAATGTTCAGATACCCAATCTCGAGATTGGGTATCTGAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024295.4-763s21c1
Sequence:CCGGCCTTGGATTCAACTATATCATCTCGAGATGATATAGTTGAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024295.4-568s21c1
Sequence:CCGGGCCAGCAGACTATTTATTCATCTCGAGATGAATAAATAGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024295.3-682s1c1
Sequence:CCGGGCTCGGTAATCAATGAGCTTACTCGAGTAAGCTCATTGATTACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024295.3-734s1c1
Sequence:CCGGCCTAATGTTCAGATACCCAATCTCGAGATTGGGTATCTGAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024295.3-461s1c1
Sequence:CCGGGCCAGCAGACTATTTATTCATCTCGAGATGAATAAATAGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024295.3-634s1c1
Sequence:CCGGCCTGCTATTTACCCTGGGTTACTCGAGTAACCCAGGGTAAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024295.3-656s1c1
Sequence:CCGGCCTTGGATTCAACTATATCATCTCGAGATGATATAGTTGAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024295
VALIDATED
DERL1 MISSION shRNA shRNA Plasmid DNA
derlin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024295.4-741s21c1
Sequence:CCGGCCTGCTATTTACCCTGGGTTACTCGAGTAACCCAGGGTAAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024295.4-841s21c1
Sequence:CCGGCCTAATGTTCAGATACCCAATCTCGAGATTGGGTATCTGAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024295.4-763s21c1
Sequence:CCGGCCTTGGATTCAACTATATCATCTCGAGATGATATAGTTGAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024295.4-568s21c1
Sequence:CCGGGCCAGCAGACTATTTATTCATCTCGAGATGAATAAATAGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024295.3-682s1c1
Sequence:CCGGGCTCGGTAATCAATGAGCTTACTCGAGTAAGCTCATTGATTACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024295.3-734s1c1
Sequence:CCGGCCTAATGTTCAGATACCCAATCTCGAGATTGGGTATCTGAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024295.3-461s1c1
Sequence:CCGGGCCAGCAGACTATTTATTCATCTCGAGATGAATAAATAGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024295.3-634s1c1
Sequence:CCGGCCTGCTATTTACCCTGGGTTACTCGAGTAACCCAGGGTAAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024295.3-656s1c1
Sequence:CCGGCCTTGGATTCAACTATATCATCTCGAGATGATATAGTTGAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024295
VALIDATED
DERL1 MISSION shRNA Lentiviral Transduction Particles
derlin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024295.4-741s21c1
Sequence:CCGGCCTGCTATTTACCCTGGGTTACTCGAGTAACCCAGGGTAAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024295.4-841s21c1
Sequence:CCGGCCTAATGTTCAGATACCCAATCTCGAGATTGGGTATCTGAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024295.4-763s21c1
Sequence:CCGGCCTTGGATTCAACTATATCATCTCGAGATGATATAGTTGAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024295.4-568s21c1
Sequence:CCGGGCCAGCAGACTATTTATTCATCTCGAGATGAATAAATAGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024295.3-682s1c1
Sequence:CCGGGCTCGGTAATCAATGAGCTTACTCGAGTAAGCTCATTGATTACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024295.3-734s1c1
Sequence:CCGGCCTAATGTTCAGATACCCAATCTCGAGATTGGGTATCTGAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024295.3-461s1c1
Sequence:CCGGGCCAGCAGACTATTTATTCATCTCGAGATGAATAAATAGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024295.3-634s1c1
Sequence:CCGGCCTGCTATTTACCCTGGGTTACTCGAGTAACCCAGGGTAAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024295.3-656s1c1
Sequence:CCGGCCTTGGATTCAACTATATCATCTCGAGATGATATAGTTGAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks