EMAIL THIS PAGE TO A FRIEND

DERL2

derlin 2

97 Gene Product Result for
Synonyms: F-LAN-1 F-LANa FLANa
UniProtKB ID: Q9GZP9, Q9Y3A7
Gene ID:
Human(51009) Summary: Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER (Oda et al., 2006 [PubMed 16449189]
Mouse(116891) Der1-like domain family, member 2
Rat(691956) Der1-like domain family, member 2
Zebrafish(554093) Der1-like domain family, member 2
cow(508465) Der1-like domain family, member 2
dog(606991) derlin 2
chicken(417498) Der1-like domain family, member 2
sheep(101105423) derlin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016041 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016041 Rosetta Predictions human pricing
XM_001079920 Rosetta Predictions rat pricing
NM_033562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042902 predicted 777
2 SASI_Hs02_00348760 predicted 545
3 SASI_Hs01_00042904 predicted 535
4 SASI_Hs01_00042905 predicted 769
5 SASI_Hs01_00042906 predicted 344
6 SASI_Hs01_00042907 predicted 382
7 SASI_Hs01_00042909 predicted 273
8 SASI_Hs01_00042911 predicted 529
9 SASI_Hs02_00348761 predicted 728
10 SASI_Hs02_00348762 predicted 888
11 SASI_Hs01_00042903 predicted 653
12 SASI_Hs01_00042908 predicted 653
13 SASI_Hs01_00042910 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365985 predicted 280
2 SASI_Rn02_00365986 predicted 280
3 SASI_Rn02_00365987 predicted 236
4 SASI_Rn02_00365988 predicted 234
5 SASI_Rn02_00365989 predicted 227
6 SASI_Rn02_00365990 predicted 259
7 SASI_Rn02_00365991 predicted 259
8 SASI_Rn02_00365992 predicted 260
9 SASI_Rn02_00365993 predicted 258
10 SASI_Rn02_00365994 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033207 predicted 1238
2 SASI_Mm01_00033208 predicted 1221
3 SASI_Mm02_00337388 predicted 884
4 SASI_Mm01_00033209 predicted 771
5 SASI_Mm01_00033210 predicted 868
6 SASI_Mm01_00033213 predicted 1114
7 SASI_Mm01_00033214 predicted 735
8 SASI_Mm02_00337389 predicted 736
9 SASI_Mm02_00337390 predicted 736
10 SASI_Mm02_00337391 predicted 285
11 SASI_Mm01_00033206 predicted 364
12 SASI_Mm01_00033211 predicted 546
13 SASI_Mm01_00033212 predicted 600
14 SASI_Mm01_00033215 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016041
VALIDATED
DERL2 MISSION shRNA Bacterial Glycerol Stock
derlin 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016041.2-921s1c1
Sequence:CCGGCCTCACTACACTGGTACTGAACTCGAGTTCAGTACCAGTGTAGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016041.2-294s1c1
Sequence:CCGGCGGACAGCAGACTTTGTATTTCTCGAGAAATACAAAGTCTGCTGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016041.2-889s1c1
Sequence:CCGGCAGAAGACATTTCCAACAGTTCTCGAGAACTGTTGGAAATGTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016041.2-380s1c1
Sequence:CCGGCCAGGCCTTTACAATAATGCTCTCGAGAGCATTATTGTAAAGGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016041.2-352s1c1
Sequence:CCGGGTCTGTTTGTGAGCTTAGTTTCTCGAGAAACTAAGCTCACAAACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016041.2-385s1c1
Sequence:CCGGCCTTTACAATAATGCTCGTCTCTCGAGAGACGAGCATTATTGTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-293s21c1
Sequence:CCGGCGGACAGCAGACTTTGTATTTCTCGAGAAATACAAAGTCTGCTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-542s21c1
Sequence:CCGGATTGCAGTTGGACACATATATCTCGAGATATATGTGTCCAACTGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-139s21c1
Sequence:CCGGGTACTTCAATCCTGAATTAATCTCGAGATTAATTCAGGATTGAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-930s21c1
Sequence:CCGGCTGGTACTGAAAGTGTAATTTCTCGAGAAATTACACTTTCAGTACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-183s21c1
Sequence:CCGGGATTAATCACCAACTTCTTATCTCGAGATAAGAAGTTGGTGATTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016041
VALIDATED
DERL2 MISSION shRNA shRNA Plasmid DNA
derlin 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016041.2-921s1c1
Sequence:CCGGCCTCACTACACTGGTACTGAACTCGAGTTCAGTACCAGTGTAGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016041.2-294s1c1
Sequence:CCGGCGGACAGCAGACTTTGTATTTCTCGAGAAATACAAAGTCTGCTGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016041.2-889s1c1
Sequence:CCGGCAGAAGACATTTCCAACAGTTCTCGAGAACTGTTGGAAATGTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016041.2-380s1c1
Sequence:CCGGCCAGGCCTTTACAATAATGCTCTCGAGAGCATTATTGTAAAGGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016041.2-352s1c1
Sequence:CCGGGTCTGTTTGTGAGCTTAGTTTCTCGAGAAACTAAGCTCACAAACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016041.2-385s1c1
Sequence:CCGGCCTTTACAATAATGCTCGTCTCTCGAGAGACGAGCATTATTGTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-293s21c1
Sequence:CCGGCGGACAGCAGACTTTGTATTTCTCGAGAAATACAAAGTCTGCTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-542s21c1
Sequence:CCGGATTGCAGTTGGACACATATATCTCGAGATATATGTGTCCAACTGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-139s21c1
Sequence:CCGGGTACTTCAATCCTGAATTAATCTCGAGATTAATTCAGGATTGAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-930s21c1
Sequence:CCGGCTGGTACTGAAAGTGTAATTTCTCGAGAAATTACACTTTCAGTACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-183s21c1
Sequence:CCGGGATTAATCACCAACTTCTTATCTCGAGATAAGAAGTTGGTGATTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016041
VALIDATED
DERL2 MISSION shRNA Lentiviral Transduction Particles
derlin 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016041.2-921s1c1
Sequence:CCGGCCTCACTACACTGGTACTGAACTCGAGTTCAGTACCAGTGTAGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016041.2-294s1c1
Sequence:CCGGCGGACAGCAGACTTTGTATTTCTCGAGAAATACAAAGTCTGCTGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016041.2-889s1c1
Sequence:CCGGCAGAAGACATTTCCAACAGTTCTCGAGAACTGTTGGAAATGTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016041.2-380s1c1
Sequence:CCGGCCAGGCCTTTACAATAATGCTCTCGAGAGCATTATTGTAAAGGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016041.2-352s1c1
Sequence:CCGGGTCTGTTTGTGAGCTTAGTTTCTCGAGAAACTAAGCTCACAAACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016041.2-385s1c1
Sequence:CCGGCCTTTACAATAATGCTCGTCTCTCGAGAGACGAGCATTATTGTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-293s21c1
Sequence:CCGGCGGACAGCAGACTTTGTATTTCTCGAGAAATACAAAGTCTGCTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-542s21c1
Sequence:CCGGATTGCAGTTGGACACATATATCTCGAGATATATGTGTCCAACTGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-139s21c1
Sequence:CCGGGTACTTCAATCCTGAATTAATCTCGAGATTAATTCAGGATTGAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-930s21c1
Sequence:CCGGCTGGTACTGAAAGTGTAATTTCTCGAGAAATTACACTTTCAGTACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016041.3-183s21c1
Sequence:CCGGGATTAATCACCAACTTCTTATCTCGAGATAAGAAGTTGGTGATTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033562
DERL2 MISSION shRNA Bacterial Glycerol Stock
derlin 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033562.2-306s1c1
Sequence:CCGGGACAGCAGACTTTGTATTTATCTCGAGATAAATACAAAGTCTGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033562.2-396s1c1
Sequence:CCGGCTTTACAATAATGCTGGTCTACTCGAGTAGACCAGCATTATTGTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033562.2-3332s1c1
Sequence:CCGGCGTCGATTTAAGTTTCTTCAACTCGAGTTGAAGAAACTTAAATCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033562.2-192s1c1
Sequence:CCGGGAGGCTAATCACCAATTTCTTCTCGAGAAGAAATTGGTGATTAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033562.3-306s21c1
Sequence:CCGGGACAGCAGACTTTGTATTTATCTCGAGATAAATACAAAGTCTGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033562.3-934s21c1
Sequence:CCGGCCTCACTATGCTGGTACTAAACTCGAGTTTAGTACCAGCATAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033562.3-552s21c1
Sequence:CCGGTATTGCAGTTGGGCACATATACTCGAGTATATGTGCCCAACTGCAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033562.3-192s21c1
Sequence:CCGGGAGGCTAATCACCAATTTCTTCTCGAGAAGAAATTGGTGATTAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033562
DERL2 MISSION shRNA shRNA Plasmid DNA
derlin 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033562.2-306s1c1
Sequence:CCGGGACAGCAGACTTTGTATTTATCTCGAGATAAATACAAAGTCTGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033562.2-396s1c1
Sequence:CCGGCTTTACAATAATGCTGGTCTACTCGAGTAGACCAGCATTATTGTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033562.2-3332s1c1
Sequence:CCGGCGTCGATTTAAGTTTCTTCAACTCGAGTTGAAGAAACTTAAATCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033562.2-192s1c1
Sequence:CCGGGAGGCTAATCACCAATTTCTTCTCGAGAAGAAATTGGTGATTAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033562.3-306s21c1
Sequence:CCGGGACAGCAGACTTTGTATTTATCTCGAGATAAATACAAAGTCTGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033562.3-934s21c1
Sequence:CCGGCCTCACTATGCTGGTACTAAACTCGAGTTTAGTACCAGCATAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033562.3-552s21c1
Sequence:CCGGTATTGCAGTTGGGCACATATACTCGAGTATATGTGCCCAACTGCAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033562.3-192s21c1
Sequence:CCGGGAGGCTAATCACCAATTTCTTCTCGAGAAGAAATTGGTGATTAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033562
DERL2 MISSION shRNA Lentiviral Transduction Particles
derlin 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033562.2-306s1c1
Sequence:CCGGGACAGCAGACTTTGTATTTATCTCGAGATAAATACAAAGTCTGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033562.2-396s1c1
Sequence:CCGGCTTTACAATAATGCTGGTCTACTCGAGTAGACCAGCATTATTGTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033562.2-3332s1c1
Sequence:CCGGCGTCGATTTAAGTTTCTTCAACTCGAGTTGAAGAAACTTAAATCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033562.2-192s1c1
Sequence:CCGGGAGGCTAATCACCAATTTCTTCTCGAGAAGAAATTGGTGATTAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033562.3-306s21c1
Sequence:CCGGGACAGCAGACTTTGTATTTATCTCGAGATAAATACAAAGTCTGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033562.3-934s21c1
Sequence:CCGGCCTCACTATGCTGGTACTAAACTCGAGTTTAGTACCAGCATAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033562.3-552s21c1
Sequence:CCGGTATTGCAGTTGGGCACATATACTCGAGTATATGTGCCCAACTGCAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033562.3-192s21c1
Sequence:CCGGGAGGCTAATCACCAATTTCTTCTCGAGAAGAAATTGGTGATTAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)