EMAIL THIS PAGE TO A FRIEND

DERL3

derlin 3

66 Gene Product Result for
Synonyms: C22orf14 IZP6 LLN2 derlin-3
UniProtKB ID: Q96Q80, F2Z3B6, Q6ICJ6, Q6PEX0, Q6ZUB5
Gene ID:
Human(91319) Summary: The protein encoded by this gene belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in the degradation of misfolded glycoproteins in the ER. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
Mouse(70377) Der1-like domain family, member 3
Rat(690315) derlin 3
Zebrafish(393877) Der1-like domain family, member 3
chicken(416934) Der1-like domain family, member 3
dog(486406) derlin 3
cow(614334) Der1-like domain family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100563 Anti-DERL3 antibody produced in rabbit affinity isolated antibody human, mouse, guinea pig, horse, bovine, canine, rat, zebrafish, rabbit
western blot pricing
SAB2701545 Anti-DERL3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
D2194 Anti-Derlin-3 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse (predicted), rat (predicted), human
immunofluorescence, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198440 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001002862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002862 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002862 Rosetta Predictions human pricing
NM_198440 Rosetta Predictions human pricing
NM_001109577 Rosetta Predictions rat pricing
NM_024440 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181152 predicted 221
2 SASI_Hs01_00181153 predicted 991
3 SASI_Hs01_00181151 predicted 224
4 SASI_Hs01_00181154 predicted 303
5 SASI_Hs02_00304233 predicted 1125
6 SASI_Hs01_00181155 predicted 1067
7 SASI_Hs01_00181156 predicted 1106
8 SASI_Hs01_00181157 predicted 72
9 SASI_Hs01_00181158 predicted 749
10 SASI_Hs01_00181159 predicted 1198
11 SASI_Hs01_00181160 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097449 predicted 221
2 SASI_Hs01_00097450 predicted 1094
3 SASI_Hs01_00097448 predicted 221
4 SASI_Hs01_00097452 predicted 304
5 SASI_Hs01_00097453 predicted 73
6 SASI_Hs01_00097454 predicted 626
7 SASI_Hs01_00097455 predicted 850
8 SASI_Hs01_00097456 predicted 925
9 SASI_Hs01_00097457 predicted 514
10 SASI_Hs02_00371950 predicted 357
11 SASI_Hs01_00097451 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249761 predicted 841
2 SASI_Rn02_00249762 predicted 853
3 SASI_Rn02_00249763 predicted 753
4 SASI_Rn02_00249764 predicted 441
5 SASI_Rn02_00249765 predicted 550
6 SASI_Rn02_00249766 predicted 1009
7 SASI_Rn02_00249767 predicted 966
8 SASI_Rn02_00249768 predicted 751
9 SASI_Rn02_00249769 predicted 352
10 SASI_Rn02_00249770 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183590 predicted 627
2 SASI_Mm01_00183591 predicted 734
3 SASI_Mm01_00183592 predicted 629
4 SASI_Mm02_00327770 predicted 1009
5 SASI_Mm02_00327771 predicted 323
6 SASI_Mm02_00327772 predicted 729
7 SASI_Mm01_00183593 predicted 550
8 SASI_Mm01_00183594 predicted 329
9 SASI_Mm01_00183595 predicted 360
10 SASI_Mm01_00183596 predicted 818
11 SASI_Mm01_00183597 predicted 335
12 SASI_Mm01_00183598 predicted 492
13 SASI_Mm01_00183599 predicted 835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024440
DERL3 MISSION shRNA Bacterial Glycerol Stock
derlin 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024440.2-330s21c1
Sequence:CCGGTCTCTTCGGTGGTGTTCTTATCTCGAGATAAGAACACCACCGAAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024440.2-446s21c1
Sequence:CCGGGGGTCAACTTCTTCGGCTTACCTCGAGGTAAGCCGAAGAAGTTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024440.2-575s21c1
Sequence:CCGGACTTCCTAGAAGACGTCTTTCCTCGAGGAAAGACGTCTTCTAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024440.2-825s21c1
Sequence:CCGGCCATCTCTGCTCAGCGGTAATCTCGAGATTACCGCTGAGCAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024440.2-530s21c1
Sequence:CCGGCGGTTGTCACAGACCTGTTAGCTCGAGCTAACAGGTCTGTGACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024440.1-1014s1c1
Sequence:CCGGGCCTGTCTTCATTTAAAGCAACTCGAGTTGCTTTAAATGAAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024440
DERL3 MISSION shRNA shRNA Plasmid DNA
derlin 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024440.2-330s21c1
Sequence:CCGGTCTCTTCGGTGGTGTTCTTATCTCGAGATAAGAACACCACCGAAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024440.2-446s21c1
Sequence:CCGGGGGTCAACTTCTTCGGCTTACCTCGAGGTAAGCCGAAGAAGTTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024440.2-575s21c1
Sequence:CCGGACTTCCTAGAAGACGTCTTTCCTCGAGGAAAGACGTCTTCTAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024440.2-825s21c1
Sequence:CCGGCCATCTCTGCTCAGCGGTAATCTCGAGATTACCGCTGAGCAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024440.2-530s21c1
Sequence:CCGGCGGTTGTCACAGACCTGTTAGCTCGAGCTAACAGGTCTGTGACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024440.1-1014s1c1
Sequence:CCGGGCCTGTCTTCATTTAAAGCAACTCGAGTTGCTTTAAATGAAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024440
DERL3 MISSION shRNA Lentiviral Transduction Particles
derlin 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024440.2-330s21c1
Sequence:CCGGTCTCTTCGGTGGTGTTCTTATCTCGAGATAAGAACACCACCGAAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024440.2-446s21c1
Sequence:CCGGGGGTCAACTTCTTCGGCTTACCTCGAGGTAAGCCGAAGAAGTTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024440.2-575s21c1
Sequence:CCGGACTTCCTAGAAGACGTCTTTCCTCGAGGAAAGACGTCTTCTAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024440.2-825s21c1
Sequence:CCGGCCATCTCTGCTCAGCGGTAATCTCGAGATTACCGCTGAGCAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024440.2-530s21c1
Sequence:CCGGCGGTTGTCACAGACCTGTTAGCTCGAGCTAACAGGTCTGTGACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024440.1-1014s1c1
Sequence:CCGGGCCTGTCTTCATTTAAAGCAACTCGAGTTGCTTTAAATGAAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198440
DERL3 MISSION shRNA Bacterial Glycerol Stock
derlin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-450s1c1
Sequence:CCGGCGTCCTTATGACCGTATCCTTCTCGAGAAGGATACGGTCATAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-423s1c1
Sequence:CCGGCTTCGTCTTCATGTTTCTCTTCTCGAGAAGAGAAACATGAAGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-625s1c1
Sequence:CCGGCTAGATCTTCAGTGCTGTATGCTCGAGCATACAGCACTGAAGATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-624s1c1
Sequence:CCGGGCTAGATCTTCAGTGCTGTATCTCGAGATACAGCACTGAAGATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-628s1c1
Sequence:CCGGGATCTTCAGTGCTGTATGCAACTCGAGTTGCATACAGCACTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-420s1c1
Sequence:CCGGCGACTTCGTCTTCATGTTTCTCTCGAGAGAAACATGAAGACGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198440.1-758s1c1
Sequence:CCGGGTGGGCCATATCTACTACTTCCTCGAGGAAGTAGTAGATATGGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-418s1c1
Sequence:CCGGGCCGACTTCGTCTTCATGTTTCTCGAGAAACATGAAGACGAAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198440
DERL3 MISSION shRNA shRNA Plasmid DNA
derlin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-450s1c1
Sequence:CCGGCGTCCTTATGACCGTATCCTTCTCGAGAAGGATACGGTCATAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-423s1c1
Sequence:CCGGCTTCGTCTTCATGTTTCTCTTCTCGAGAAGAGAAACATGAAGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-625s1c1
Sequence:CCGGCTAGATCTTCAGTGCTGTATGCTCGAGCATACAGCACTGAAGATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-624s1c1
Sequence:CCGGGCTAGATCTTCAGTGCTGTATCTCGAGATACAGCACTGAAGATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-628s1c1
Sequence:CCGGGATCTTCAGTGCTGTATGCAACTCGAGTTGCATACAGCACTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-420s1c1
Sequence:CCGGCGACTTCGTCTTCATGTTTCTCTCGAGAGAAACATGAAGACGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198440.1-758s1c1
Sequence:CCGGGTGGGCCATATCTACTACTTCCTCGAGGAAGTAGTAGATATGGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-418s1c1
Sequence:CCGGGCCGACTTCGTCTTCATGTTTCTCGAGAAACATGAAGACGAAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198440
DERL3 MISSION shRNA Lentiviral Transduction Particles
derlin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-450s1c1
Sequence:CCGGCGTCCTTATGACCGTATCCTTCTCGAGAAGGATACGGTCATAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-423s1c1
Sequence:CCGGCTTCGTCTTCATGTTTCTCTTCTCGAGAAGAGAAACATGAAGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-625s1c1
Sequence:CCGGCTAGATCTTCAGTGCTGTATGCTCGAGCATACAGCACTGAAGATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-624s1c1
Sequence:CCGGGCTAGATCTTCAGTGCTGTATCTCGAGATACAGCACTGAAGATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-628s1c1
Sequence:CCGGGATCTTCAGTGCTGTATGCAACTCGAGTTGCATACAGCACTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-420s1c1
Sequence:CCGGCGACTTCGTCTTCATGTTTCTCTCGAGAGAAACATGAAGACGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198440.1-758s1c1
Sequence:CCGGGTGGGCCATATCTACTACTTCCTCGAGGAAGTAGTAGATATGGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198440.1-418s1c1
Sequence:CCGGGCCGACTTCGTCTTCATGTTTCTCGAGAAACATGAAGACGAAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002862
DERL3 MISSION shRNA Bacterial Glycerol Stock
derlin 3
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000160747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002862.1-1569s1c1
Sequence:CCGGCCTGTCCATGTTGTGGTTTATCTCGAGATAAACCACAACATGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002862
DERL3 MISSION shRNA shRNA Plasmid DNA
derlin 3
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000160747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002862.1-1569s1c1
Sequence:CCGGCCTGTCCATGTTGTGGTTTATCTCGAGATAAACCACAACATGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002862
DERL3 MISSION shRNA Lentiviral Transduction Particles
derlin 3
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000160747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002862.1-1569s1c1
Sequence:CCGGCCTGTCCATGTTGTGGTTTATCTCGAGATAAACCACAACATGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks