EMAIL THIS PAGE TO A FRIEND

DES

desmin

97 Gene Product Result for
Synonyms: CSM1 CSM2 LGMD2R
Gene ID:
Human(1674) Summary: This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane. Mutations in this gene are associated with desmin-related myopathy, a familial cardiac and skeletal myopathy (CSM), and with distal myopathies. [provided by RefSeq, Jul 2008]
Mouse(13346) desmin
Rat(64362) desmin
cow(280765) desmin
dog(497091) desmin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104887 Anti-DES (426-439) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA018803 Anti-DES antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV41482 Anti-DES antibody produced in rabbit IgG fraction of antiserum bovine, horse, rabbit, rat, rabbit, pig, guinea pig, human, canine, mouse
western blot pricing
SAB2100564 Anti-DES antibody produced in rabbit affinity isolated antibody pig, horse, rabbit, rat, bovine, canine, rabbit, human, guinea pig, mouse
western blot pricing
SAB1306297 ANTI-DESMIN (T16) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2500306 Anti-Desmin antibody produced in goat pig, human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
D8281 Anti-Desmin antibody produced in rabbit whole antiserum mouse, human, chicken, bovine
immunofluorescence, western blot pricing
SAB5500093 Anti-Desmin antibody, Rabbit monoclonal clone SP138, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB1306249 ANTI-DESMIN(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4500643 Anti-Desmin, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4500642 Anti-Desmin, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504302 Anti-phospho-Desmin (pSer60) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
AMAB91302 Monoclonal Anti-DES antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL4501, purified immunoglobulin New human
western blot pricing
AMAB91303 Monoclonal Anti-DES antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL4502, purified immunoglobulin New human
western blot pricing
SAB1402171 Monoclonal Anti-DES, (C-terminal) antibody produced in mouse clone 1D12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1305506 MONOCLONAL ANTI-DESM antibody produced in mouse clone 290CT7.1.1, purified immunoglobulin, buffered aqueous solution human
western blot pricing
D1033 Monoclonal Anti-Desmin antibody produced in mouse clone DE-U-10, ascites fluid goat, mouse, bovine, rat, hamster, rabbit, chicken, viper, feline, lizard, sheep, human
immunofluorescence, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010043 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010043 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010043 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001927 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001927 Rosetta Predictions human pricing
NM_022531 Rosetta Predictions rat pricing
NM_010043 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113084 predicted 782
2 SASI_Hs01_00113085 predicted 1346
3 SASI_Hs01_00113086 predicted 1066
4 SASI_Hs02_00332821 predicted 364
5 SASI_Hs01_00113087 predicted 939
6 SASI_Hs01_00113088 predicted 1476
7 SASI_Hs01_00113089 predicted 903
8 SASI_Hs01_00113090 predicted 1403
9 SASI_Hs01_00113091 predicted 806
10 SASI_Hs01_00113093 predicted 1132
11 SASI_Hs01_00113092 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030601 predicted 635
2 SASI_Rn01_00030602 predicted 1182
3 SASI_Rn01_00030603 predicted 1057
4 SASI_Rn01_00030604 predicted 1700
5 SASI_Rn01_00030606 predicted 1583
6 SASI_Rn01_00030607 predicted 1313
7 SASI_Rn02_00263278 predicted 1338
8 SASI_Rn01_00030609 predicted 1207
9 SASI_Rn01_00030610 predicted 1789
10 SASI_Rn02_00263279 predicted 1048
11 SASI_Rn01_00030605 predicted 933
12 SASI_Rn01_00030608 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167901 predicted 1402
2 SASI_Mm01_00167902 predicted 1314
3 SASI_Mm01_00167903 predicted 1677
4 SASI_Mm01_00167904 predicted 1540
5 SASI_Mm01_00167905 predicted 607
6 SASI_Mm01_00167906 predicted 930
7 SASI_Mm01_00167907 predicted 926
8 SASI_Mm01_00167908 predicted 659
9 SASI_Mm01_00167909 predicted 1687
10 SASI_Mm02_00317680 predicted 661
11 SASI_Mm01_00167910 predicted 971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010043
DES MISSION shRNA Bacterial Glycerol Stock
desmin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010043.1-1721s1c1
Sequence:CCGGCCAGCTCAAGTCATCGCCCTTCTCGAGAAGGGCGATGACTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010043.1-1193s1c1
Sequence:CCGGCCGACACCTAAAGGATGAGATCTCGAGATCTCATCCTTTAGGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010043.1-987s1c1
Sequence:CCGGGCAGCCAATAAGAACAACGATCTCGAGATCGTTGTTCTTATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010043.1-1055s1c1
Sequence:CCGGCCAGTCCTACACCTGCGAGATCTCGAGATCTCGCAGGTGTAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010043.1-1310s1c1
Sequence:CCGGGAGCAGGATCAACCTTCCTATCTCGAGATAGGAAGGTTGATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010043
DES MISSION shRNA shRNA Plasmid DNA
desmin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010043.1-1721s1c1
Sequence:CCGGCCAGCTCAAGTCATCGCCCTTCTCGAGAAGGGCGATGACTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010043.1-1193s1c1
Sequence:CCGGCCGACACCTAAAGGATGAGATCTCGAGATCTCATCCTTTAGGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010043.1-987s1c1
Sequence:CCGGGCAGCCAATAAGAACAACGATCTCGAGATCGTTGTTCTTATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010043.1-1055s1c1
Sequence:CCGGCCAGTCCTACACCTGCGAGATCTCGAGATCTCGCAGGTGTAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010043.1-1310s1c1
Sequence:CCGGGAGCAGGATCAACCTTCCTATCTCGAGATAGGAAGGTTGATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010043
DES MISSION shRNA Lentiviral Transduction Particles
desmin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010043.1-1721s1c1
Sequence:CCGGCCAGCTCAAGTCATCGCCCTTCTCGAGAAGGGCGATGACTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010043.1-1193s1c1
Sequence:CCGGCCGACACCTAAAGGATGAGATCTCGAGATCTCATCCTTTAGGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010043.1-987s1c1
Sequence:CCGGGCAGCCAATAAGAACAACGATCTCGAGATCGTTGTTCTTATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010043.1-1055s1c1
Sequence:CCGGCCAGTCCTACACCTGCGAGATCTCGAGATCTCGCAGGTGTAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010043.1-1310s1c1
Sequence:CCGGGAGCAGGATCAACCTTCCTATCTCGAGATAGGAAGGTTGATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001927
DES MISSION shRNA Bacterial Glycerol Stock
desmin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-1125s1c1
Sequence:CCGGCGGGAATTGGAGGACCGATTTCTCGAGAAATCGGTCCTCCAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-437s1c1
Sequence:CCGGGCCAATCTACATGGAGAAGGTCTCGAGACCTTCTCCATGTAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-786s1c1
Sequence:CCGGGCGTTCCTTAAGAAAGTGCATCTCGAGATGCACTTTCTTAAGGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-1397s1c1
Sequence:CCGGCCATACCAAGAAGACGGTGATCTCGAGATCACCGTCTTCTTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-930s1c1
Sequence:CCGGGCGGCTAAGAACATTTCTGAACTCGAGTTCAGAAATGTTCTTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001927
DES MISSION shRNA shRNA Plasmid DNA
desmin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-1125s1c1
Sequence:CCGGCGGGAATTGGAGGACCGATTTCTCGAGAAATCGGTCCTCCAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-437s1c1
Sequence:CCGGGCCAATCTACATGGAGAAGGTCTCGAGACCTTCTCCATGTAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-786s1c1
Sequence:CCGGGCGTTCCTTAAGAAAGTGCATCTCGAGATGCACTTTCTTAAGGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-1397s1c1
Sequence:CCGGCCATACCAAGAAGACGGTGATCTCGAGATCACCGTCTTCTTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-930s1c1
Sequence:CCGGGCGGCTAAGAACATTTCTGAACTCGAGTTCAGAAATGTTCTTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001927
DES MISSION shRNA Lentiviral Transduction Particles
desmin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-1125s1c1
Sequence:CCGGCGGGAATTGGAGGACCGATTTCTCGAGAAATCGGTCCTCCAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-437s1c1
Sequence:CCGGGCCAATCTACATGGAGAAGGTCTCGAGACCTTCTCCATGTAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-786s1c1
Sequence:CCGGGCGTTCCTTAAGAAAGTGCATCTCGAGATGCACTTTCTTAAGGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-1397s1c1
Sequence:CCGGCCATACCAAGAAGACGGTGATCTCGAGATCACCGTCTTCTTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001927.2-930s1c1
Sequence:CCGGGCGGCTAAGAACATTTCTGAACTCGAGTTCAGAAATGTTCTTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks