EMAIL THIS PAGE TO A FRIEND

DESI1

desumoylating isopeptidase 1

54 Gene Product Result for
Synonyms: D15Wsu75e DESI2 DJ347H13.4 DeSI-1 FAM152B PPPDE2
UniProtKB ID: Q6ICB0
Gene ID:
Mouse(28075) desumoylating isopeptidase 1
Rat(315160) desumoylating isopeptidase 1
chicken(770448) desumoylating isopeptidase 1
domestic cat(101081148) desumoylating isopeptidase 1
sheep(101111872) desumoylating isopeptidase 1
naked mole-rat(101703813) desumoylating isopeptidase 1
domestic guinea pig(100712832) desumoylating isopeptidase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134095 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134095 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134095 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015704 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015704 Rosetta Predictions human pricing
NM_001025703 Rosetta Predictions rat pricing
NM_134095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348375 predicted 434
2 SASI_Hs02_00348376 predicted 423
3 SASI_Hs01_00113103 predicted 429
4 SASI_Hs01_00113104 predicted 407
5 SASI_Hs02_00348377 predicted 361
6 SASI_Hs01_00113105 predicted 435
7 SASI_Hs01_00113106 predicted 399
8 SASI_Hs01_00113110 predicted 429
9 SASI_Hs01_00113111 predicted 390
10 SASI_Hs02_00348378 predicted 450
11 SASI_Hs01_00113102 predicted 372
12 SASI_Hs01_00113107 predicted 278
13 SASI_Hs01_00113108 predicted 476
14 SASI_Hs01_00113109 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082740 predicted 873
2 SASI_Rn01_00082741 predicted 277
3 SASI_Rn01_00082742 predicted 836
4 SASI_Rn01_00082743 predicted 1174
5 SASI_Rn01_00082744 predicted 502
6 SASI_Rn01_00082745 predicted 1080
7 SASI_Rn01_00082746 predicted 579
8 SASI_Rn01_00082747 predicted 875
9 SASI_Rn01_00082748 predicted 484
10 SASI_Rn01_00082749 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020136 predicted 1175
2 SASI_Mm01_00020137 predicted 486
3 SASI_Mm01_00020138 predicted 529
4 SASI_Mm01_00020140 predicted 290
5 SASI_Mm01_00020141 predicted 1107
6 SASI_Mm01_00020142 predicted 866
7 SASI_Mm01_00020143 predicted 1161
8 SASI_Mm01_00020144 predicted 1178
9 SASI_Mm01_00020145 predicted 1166
10 SASI_Mm02_00339325 predicted 566
11 SASI_Mm01_00020139 predicted 834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134095
DESI1 MISSION shRNA Bacterial Glycerol Stock
desumoylating isopeptidase 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192557    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134095.2-2440s1c1
Sequence:CCGGGCTTGAATTATCTCCTGTCATCTCGAGATGACAGGAGATAATTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134095.2-575s1c1
Sequence:CCGGGAAGTTCTTTCCACGCCCTTTCTCGAGAAAGGGCGTGGAAAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134095.2-490s21c1
Sequence:CCGGACACAACTGTAACACCTTTAGCTCGAGCTAAAGGTGTTACAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134095.2-536s21c1
Sequence:CCGGGGGCGAAAGATCCCTTCTTACCTCGAGGTAAGAAGGGATCTTTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134095.2-1797s21c1
Sequence:CCGGCAGTCTTCTACTAGCTAATATCTCGAGATATTAGCTAGTAGAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134095.2-498s1c1
Sequence:CCGGGTAACACCTTTAGCAATGAAGCTCGAGCTTCATTGCTAAAGGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134095.2-321s21c1
Sequence:CCGGTCTTCGGCAGCAGCGGTATTTCTCGAGAAATACCGCTGCTGCCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134095
DESI1 MISSION shRNA shRNA Plasmid DNA
desumoylating isopeptidase 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192557    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134095.2-2440s1c1
Sequence:CCGGGCTTGAATTATCTCCTGTCATCTCGAGATGACAGGAGATAATTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134095.2-575s1c1
Sequence:CCGGGAAGTTCTTTCCACGCCCTTTCTCGAGAAAGGGCGTGGAAAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134095.2-490s21c1
Sequence:CCGGACACAACTGTAACACCTTTAGCTCGAGCTAAAGGTGTTACAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134095.2-536s21c1
Sequence:CCGGGGGCGAAAGATCCCTTCTTACCTCGAGGTAAGAAGGGATCTTTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134095.2-1797s21c1
Sequence:CCGGCAGTCTTCTACTAGCTAATATCTCGAGATATTAGCTAGTAGAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134095.2-498s1c1
Sequence:CCGGGTAACACCTTTAGCAATGAAGCTCGAGCTTCATTGCTAAAGGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134095.2-321s21c1
Sequence:CCGGTCTTCGGCAGCAGCGGTATTTCTCGAGAAATACCGCTGCTGCCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134095
DESI1 MISSION shRNA Lentiviral Transduction Particles
desumoylating isopeptidase 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192557    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134095.2-2440s1c1
Sequence:CCGGGCTTGAATTATCTCCTGTCATCTCGAGATGACAGGAGATAATTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134095.2-575s1c1
Sequence:CCGGGAAGTTCTTTCCACGCCCTTTCTCGAGAAAGGGCGTGGAAAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134095.2-490s21c1
Sequence:CCGGACACAACTGTAACACCTTTAGCTCGAGCTAAAGGTGTTACAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134095.2-536s21c1
Sequence:CCGGGGGCGAAAGATCCCTTCTTACCTCGAGGTAAGAAGGGATCTTTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134095.2-1797s21c1
Sequence:CCGGCAGTCTTCTACTAGCTAATATCTCGAGATATTAGCTAGTAGAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134095.2-498s1c1
Sequence:CCGGGTAACACCTTTAGCAATGAAGCTCGAGCTTCATTGCTAAAGGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134095.2-321s21c1
Sequence:CCGGTCTTCGGCAGCAGCGGTATTTCTCGAGAAATACCGCTGCTGCCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015704
DESI1 MISSION shRNA Bacterial Glycerol Stock
desumoylating isopeptidase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-373s1c1
Sequence:CCGGCTACAACCTCTTTGAACACAACTCGAGTTGTGTTCAAAGAGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015704.1-303s1c1
Sequence:CCGGCAGAAGTCACAGAAGAAATCTCTCGAGAGATTTCTTCTGTGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-312s1c1
Sequence:CCGGCAGAAGAAATCTTTCTGGAGTCTCGAGACTCCAGAAAGATTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-436s1c1
Sequence:CCGGGCGGAAGATTCCTTCTTACATCTCGAGATGTAAGAAGGAATCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015704.1-209s1c1
Sequence:CCGGGATGAGTTCTTCTTCGGCAGTCTCGAGACTGCCGAAGAAGAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-368s1c1
Sequence:CCGGGAGGCCTACAACCTCTTTGAACTCGAGTTCAAAGAGGTTGTAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-202s1c1
Sequence:CCGGGCACAAGGATGAGTTCTTCTTCTCGAGAAGAAGAACTCATCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015704.1-184s1c1
Sequence:CCGGGCACACATCCATAGTTGTGCACTCGAGTGCACAACTATGGATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015704
DESI1 MISSION shRNA shRNA Plasmid DNA
desumoylating isopeptidase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-373s1c1
Sequence:CCGGCTACAACCTCTTTGAACACAACTCGAGTTGTGTTCAAAGAGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015704.1-303s1c1
Sequence:CCGGCAGAAGTCACAGAAGAAATCTCTCGAGAGATTTCTTCTGTGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-312s1c1
Sequence:CCGGCAGAAGAAATCTTTCTGGAGTCTCGAGACTCCAGAAAGATTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-436s1c1
Sequence:CCGGGCGGAAGATTCCTTCTTACATCTCGAGATGTAAGAAGGAATCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015704.1-209s1c1
Sequence:CCGGGATGAGTTCTTCTTCGGCAGTCTCGAGACTGCCGAAGAAGAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-368s1c1
Sequence:CCGGGAGGCCTACAACCTCTTTGAACTCGAGTTCAAAGAGGTTGTAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-202s1c1
Sequence:CCGGGCACAAGGATGAGTTCTTCTTCTCGAGAAGAAGAACTCATCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015704.1-184s1c1
Sequence:CCGGGCACACATCCATAGTTGTGCACTCGAGTGCACAACTATGGATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015704
DESI1 MISSION shRNA Lentiviral Transduction Particles
desumoylating isopeptidase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-373s1c1
Sequence:CCGGCTACAACCTCTTTGAACACAACTCGAGTTGTGTTCAAAGAGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015704.1-303s1c1
Sequence:CCGGCAGAAGTCACAGAAGAAATCTCTCGAGAGATTTCTTCTGTGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-312s1c1
Sequence:CCGGCAGAAGAAATCTTTCTGGAGTCTCGAGACTCCAGAAAGATTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-436s1c1
Sequence:CCGGGCGGAAGATTCCTTCTTACATCTCGAGATGTAAGAAGGAATCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015704.1-209s1c1
Sequence:CCGGGATGAGTTCTTCTTCGGCAGTCTCGAGACTGCCGAAGAAGAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-368s1c1
Sequence:CCGGGAGGCCTACAACCTCTTTGAACTCGAGTTCAAAGAGGTTGTAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015704.1-202s1c1
Sequence:CCGGGCACAAGGATGAGTTCTTCTTCTCGAGAAGAAGAACTCATCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015704.1-184s1c1
Sequence:CCGGGCACACATCCATAGTTGTGCACTCGAGTGCACAACTATGGATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks