EMAIL THIS PAGE TO A FRIEND

DESI2

desumoylating isopeptidase 2

199 Gene Product Result for
Synonyms: C1orf121 DESI DESI1 DeSI-2 FAM152A PNAS-4 PPPDE1
UniProtKB ID: Q9BSY9, B1APK6, Q5VVC6, Q9NYS2, Q9Y3E4
Gene ID:
Mouse(78825) desumoylating isopeptidase 2
Rat(289277) desumoylating isopeptidase 2
Zebrafish(445138) desumoylating isopeptidase 2
domestic cat(101089483) desumoylating isopeptidase 2
domestic guinea pig(100724590) desumoylating isopeptidase 2
naked mole-rat(101697135) desumoylating isopeptidase 2
sheep(101117263) desumoylating isopeptidase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016076 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016076 Rosetta Predictions human pricing
NM_001013873 Rosetta Predictions rat pricing
NM_024282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012534 predicted 721
2 SASI_Hs01_00012535 predicted 495
3 SASI_Hs01_00012536 predicted 440
4 SASI_Hs01_00012537 predicted 1265
5 SASI_Hs01_00012538 predicted 641
6 SASI_Hs01_00012541 predicted 652
7 SASI_Hs01_00012542 predicted 283
8 SASI_Hs02_00348820 predicted 369
9 SASI_Hs01_00012543 predicted 317
10 SASI_Hs02_00348821 predicted 662
11 SASI_Hs01_00012539 predicted 537
12 SASI_Hs01_00012540 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013873 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113402 predicted 764
2 SASI_Rn01_00113403 predicted 521
3 SASI_Rn01_00113404 predicted 605
4 SASI_Rn01_00113405 predicted 460
5 SASI_Rn01_00113406 predicted 1406
6 SASI_Rn01_00113407 predicted 420
7 SASI_Rn01_00113408 predicted 708
8 SASI_Rn01_00113409 predicted 487
9 SASI_Rn01_00113410 predicted 459
10 SASI_Rn01_00113411 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170173 predicted 556
2 SASI_Mm01_00170174 predicted 930
3 SASI_Mm01_00170175 predicted 863
4 SASI_Mm01_00170177 predicted 722
5 SASI_Mm01_00170178 predicted 951
6 SASI_Mm01_00170179 predicted 518
7 SASI_Mm01_00170181 predicted 937
8 SASI_Mm02_00327706 predicted 607
9 SASI_Mm02_00327707 predicted 903
10 SASI_Mm02_00327708 predicted 681
11 SASI_Mm01_00170176 predicted 268
12 SASI_Mm01_00170180 predicted 825
13 SASI_Mm01_00170182 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016076
VALIDATED
DESI2 MISSION shRNA Bacterial Glycerol Stock
desumoylating isopeptidase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016076.3-689s21c1
Sequence:CCGGAGAGTTGCCTCCCGAAGGAGTCTCGAGACTCCTTCGGGAGGCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016076.3-729s21c1
Sequence:CCGGGCAGTCTAGTGTCAGCCAAGACTCGAGTCTTGGCTGACACTAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016076.3-1127s21c1
Sequence:CCGGAGTATCTTGTATCGCTGTTTACTCGAGTAAACAGCGATACAAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016076.3-315s21c1
Sequence:CCGGGAACGAATATACCTCATCCATCTCGAGATGGATGAGGTATATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016076.3-1231s21c1
Sequence:CCGGCTGACAATTGCCAGATCTATGCTCGAGCATAGATCTGGCAATTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168007    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016076.2-3477s1c1
Sequence:CCGGCCACAGCAATAGAGCAAGTTACTCGAGTAACTTGCTCTATTGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016076.2-582s1c1
Sequence:CCGGGCTTTATCAGAGATTCTTTGTCTCGAGACAAAGAATCTCTGATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016076.2-475s1c1
Sequence:CCGGCGGACTTCCTAGAAGATGATACTCGAGTATCATCTTCTAGGAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016076.2-605s1c1
Sequence:CCGGGAAAGAGATTCCTCGCTGGATCTCGAGATCCAGCGAGGAATCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016076
VALIDATED
DESI2 MISSION shRNA shRNA Plasmid DNA
desumoylating isopeptidase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016076.3-689s21c1
Sequence:CCGGAGAGTTGCCTCCCGAAGGAGTCTCGAGACTCCTTCGGGAGGCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016076.3-729s21c1
Sequence:CCGGGCAGTCTAGTGTCAGCCAAGACTCGAGTCTTGGCTGACACTAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016076.3-1127s21c1
Sequence:CCGGAGTATCTTGTATCGCTGTTTACTCGAGTAAACAGCGATACAAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016076.3-315s21c1
Sequence:CCGGGAACGAATATACCTCATCCATCTCGAGATGGATGAGGTATATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016076.3-1231s21c1
Sequence:CCGGCTGACAATTGCCAGATCTATGCTCGAGCATAGATCTGGCAATTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168007    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016076.2-3477s1c1
Sequence:CCGGCCACAGCAATAGAGCAAGTTACTCGAGTAACTTGCTCTATTGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016076.2-582s1c1
Sequence:CCGGGCTTTATCAGAGATTCTTTGTCTCGAGACAAAGAATCTCTGATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016076.2-475s1c1
Sequence:CCGGCGGACTTCCTAGAAGATGATACTCGAGTATCATCTTCTAGGAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016076.2-605s1c1
Sequence:CCGGGAAAGAGATTCCTCGCTGGATCTCGAGATCCAGCGAGGAATCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016076
VALIDATED
DESI2 MISSION shRNA Lentiviral Transduction Particles
desumoylating isopeptidase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016076.3-689s21c1
Sequence:CCGGAGAGTTGCCTCCCGAAGGAGTCTCGAGACTCCTTCGGGAGGCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016076.3-729s21c1
Sequence:CCGGGCAGTCTAGTGTCAGCCAAGACTCGAGTCTTGGCTGACACTAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016076.3-1127s21c1
Sequence:CCGGAGTATCTTGTATCGCTGTTTACTCGAGTAAACAGCGATACAAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016076.3-315s21c1
Sequence:CCGGGAACGAATATACCTCATCCATCTCGAGATGGATGAGGTATATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016076.3-1231s21c1
Sequence:CCGGCTGACAATTGCCAGATCTATGCTCGAGCATAGATCTGGCAATTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168007    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016076.2-3477s1c1
Sequence:CCGGCCACAGCAATAGAGCAAGTTACTCGAGTAACTTGCTCTATTGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016076.2-582s1c1
Sequence:CCGGGCTTTATCAGAGATTCTTTGTCTCGAGACAAAGAATCTCTGATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016076.2-475s1c1
Sequence:CCGGCGGACTTCCTAGAAGATGATACTCGAGTATCATCTTCTAGGAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016076.2-605s1c1
Sequence:CCGGGAAAGAGATTCCTCGCTGGATCTCGAGATCCAGCGAGGAATCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024282
DESI2 MISSION shRNA Bacterial Glycerol Stock
desumoylating isopeptidase 2
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024282.3-587s21c1
Sequence:CCGGCATTCTGGAATTGAAGTATATCTCGAGATATACTTCAATTCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024282.3-2135s21c1
Sequence:CCGGCCGCACCTCATAATAGAGATTCTCGAGAATCTCTATTATGAGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024282.3-1065s21c1
Sequence:CCGGGGCGTCACACTAAACTATAAGCTCGAGCTTATAGTTTAGTGTGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024282.3-683s1c1
Sequence:CCGGGAGCTAGGAGAAACATTTAAACTCGAGTTTAAATGTTTCTCCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024282.3-834s1c1
Sequence:CCGGCTTCAGCTTTATCAGAGATTCCTCGAGGAATCTCTGATAAAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024282.3-1064s1c1
Sequence:CCGGGGGCGTCACACTAAACTATAACTCGAGTTATAGTTTAGTGTGACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024282.3-2431s21c1
Sequence:CCGGGCAGCTTTAGATACGTGATTACTCGAGTAATCACGTATCTAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024282.3-550s21c1
Sequence:CCGGGAATGAATACACCTCATCTATCTCGAGATAGATGAGGTGTATTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024282.2-690s1c1
Sequence:CCGGGAACTCCAGGATGAACTAGAACTCGAGTTCTAGTTCATCCTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197611    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024282.2-2399s1c1
Sequence:CCGGCCCTCTTTATAGGGAAAGTAACTCGAGTTACTTTCCCTATAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024282.2-669s1c1
Sequence:CCGGCTTCAGTCTAGTGTCAGCCAACTCGAGTTGGCTGACACTAGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024282.2-1977s1c1
Sequence:CCGGCCGCACCTCATAATAGAGATTCTCGAGAATCTCTATTATGAGGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024282.2-2273s1c1
Sequence:CCGGGCAGCTTTAGATACGTGATTACTCGAGTAATCACGTATCTAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024282.2-257s1c1
Sequence:CCGGGAATGAATACACCTCATCTATCTCGAGATAGATGAGGTGTATTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024282
DESI2 MISSION shRNA shRNA Plasmid DNA
desumoylating isopeptidase 2
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024282.3-587s21c1
Sequence:CCGGCATTCTGGAATTGAAGTATATCTCGAGATATACTTCAATTCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024282.3-2135s21c1
Sequence:CCGGCCGCACCTCATAATAGAGATTCTCGAGAATCTCTATTATGAGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024282.3-1065s21c1
Sequence:CCGGGGCGTCACACTAAACTATAAGCTCGAGCTTATAGTTTAGTGTGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024282.3-683s1c1
Sequence:CCGGGAGCTAGGAGAAACATTTAAACTCGAGTTTAAATGTTTCTCCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024282.3-834s1c1
Sequence:CCGGCTTCAGCTTTATCAGAGATTCCTCGAGGAATCTCTGATAAAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024282.3-1064s1c1
Sequence:CCGGGGGCGTCACACTAAACTATAACTCGAGTTATAGTTTAGTGTGACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024282.3-2431s21c1
Sequence:CCGGGCAGCTTTAGATACGTGATTACTCGAGTAATCACGTATCTAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024282.3-550s21c1
Sequence:CCGGGAATGAATACACCTCATCTATCTCGAGATAGATGAGGTGTATTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024282.2-690s1c1
Sequence:CCGGGAACTCCAGGATGAACTAGAACTCGAGTTCTAGTTCATCCTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197611    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024282.2-2399s1c1
Sequence:CCGGCCCTCTTTATAGGGAAAGTAACTCGAGTTACTTTCCCTATAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024282.2-669s1c1
Sequence:CCGGCTTCAGTCTAGTGTCAGCCAACTCGAGTTGGCTGACACTAGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024282.2-1977s1c1
Sequence:CCGGCCGCACCTCATAATAGAGATTCTCGAGAATCTCTATTATGAGGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024282.2-2273s1c1
Sequence:CCGGGCAGCTTTAGATACGTGATTACTCGAGTAATCACGTATCTAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024282.2-257s1c1
Sequence:CCGGGAATGAATACACCTCATCTATCTCGAGATAGATGAGGTGTATTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024282
DESI2 MISSION shRNA Lentiviral Transduction Particles
desumoylating isopeptidase 2
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024282.3-587s21c1
Sequence:CCGGCATTCTGGAATTGAAGTATATCTCGAGATATACTTCAATTCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024282.3-2135s21c1
Sequence:CCGGCCGCACCTCATAATAGAGATTCTCGAGAATCTCTATTATGAGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024282.3-1065s21c1
Sequence:CCGGGGCGTCACACTAAACTATAAGCTCGAGCTTATAGTTTAGTGTGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024282.3-683s1c1
Sequence:CCGGGAGCTAGGAGAAACATTTAAACTCGAGTTTAAATGTTTCTCCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024282.3-834s1c1
Sequence:CCGGCTTCAGCTTTATCAGAGATTCCTCGAGGAATCTCTGATAAAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024282.3-1064s1c1
Sequence:CCGGGGGCGTCACACTAAACTATAACTCGAGTTATAGTTTAGTGTGACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024282.3-2431s21c1
Sequence:CCGGGCAGCTTTAGATACGTGATTACTCGAGTAATCACGTATCTAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024282.3-550s21c1
Sequence:CCGGGAATGAATACACCTCATCTATCTCGAGATAGATGAGGTGTATTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024282.2-690s1c1
Sequence:CCGGGAACTCCAGGATGAACTAGAACTCGAGTTCTAGTTCATCCTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197611    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024282.2-2399s1c1
Sequence:CCGGCCCTCTTTATAGGGAAAGTAACTCGAGTTACTTTCCCTATAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024282.2-669s1c1
Sequence:CCGGCTTCAGTCTAGTGTCAGCCAACTCGAGTTGGCTGACACTAGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024282.2-1977s1c1
Sequence:CCGGCCGCACCTCATAATAGAGATTCTCGAGAATCTCTATTATGAGGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024282.2-2273s1c1
Sequence:CCGGGCAGCTTTAGATACGTGATTACTCGAGTAATCACGTATCTAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024282.2-257s1c1
Sequence:CCGGGAATGAATACACCTCATCTATCTCGAGATAGATGAGGTGTATTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks