EMAIL THIS PAGE TO A FRIEND

DET1

de-etiolated homolog 1 (Arabidopsis)

72 Gene Product Result for
UniProtKB ID: Q7L5Y6, B3KNN6, Q2VPC0, Q9NWD5
Gene ID:
Mouse(76375) de-etiolated homolog 1 (Arabidopsis)
Rat(308775) de-etiolated homolog 1 (Arabidopsis)
Zebrafish(324089) de-etiolated homolog 1 (Arabidopsis)
dog(479036) de-etiolated homolog 1 (Arabidopsis)
Horse(100053984) de-etiolated homolog 1 (Arabidopsis)
cow(541005) de-etiolated homolog 1 (Arabidopsis)
domestic cat(101084794) de-etiolated homolog 1 (Arabidopsis)
Thale Cress(826609) light-mediated development protein DET1
chicken(415497) de-etiolated homolog 1 (Arabidopsis)
domestic guinea pig(100732872) de-etiolated homolog 1 (Arabidopsis)
naked mole-rat(101725685) de-etiolated homolog 1 (Arabidopsis)
sheep(101115993) de-etiolated homolog 1 (Arabidopsis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017996 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008511 MISSION® esiRNA esiRNA targeting human DET1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017996 Rosetta Predictions human pricing
NM_001037194 Rosetta Predictions rat pricing
NM_029585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108521 predicted 1799
2 SASI_Hs01_00108522 predicted 1635
3 SASI_Hs01_00108523 predicted 757
4 SASI_Hs01_00108524 predicted 1628
5 SASI_Hs02_00351058 predicted 1077
6 SASI_Hs01_00108525 predicted 795
7 SASI_Hs02_00351059 predicted 362
8 SASI_Hs01_00108527 predicted 1792
9 SASI_Hs01_00108528 predicted 1468
10 SASI_Hs01_00108530 predicted 1227
11 SASI_Hs01_00108526 predicted 1572
12 SASI_Hs01_00108529 predicted 1339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039417 predicted 1372
2 SASI_Rn01_00039418 predicted 1436
3 SASI_Rn01_00039419 predicted 544
4 SASI_Rn01_00039421 predicted 1421
5 SASI_Rn01_00039422 predicted 1383
6 SASI_Rn01_00039423 predicted 1403
7 SASI_Rn01_00039424 predicted 1404
8 SASI_Rn01_00039425 predicted 1080
9 SASI_Rn02_00204291 predicted 1270
10 SASI_Rn01_00039426 predicted 1574
11 SASI_Rn01_00039420 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173076 predicted 1763
2 SASI_Mm01_00173077 predicted 1354
3 SASI_Mm01_00173079 predicted 351
4 SASI_Mm02_00335547 predicted 522
5 SASI_Mm01_00173080 predicted 283
6 SASI_Mm01_00173081 predicted 821
7 SASI_Mm01_00173082 predicted 1398
8 SASI_Mm01_00173084 predicted 1845
9 SASI_Mm02_00335548 predicted 1314
10 SASI_Mm01_00173085 predicted 1251
11 SASI_Mm01_00173078 predicted 525
12 SASI_Mm01_00173083 predicted 1232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017996
DET1 MISSION shRNA Bacterial Glycerol Stock
de-etiolated homolog 1 (Arabidopsis)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178955    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017996.2-1862s1c1
Sequence:CCGGCCAGATTATCTGGTCTTCCAACTCGAGTTGGAAGACCAGATAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150230    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017996.2-2135s1c1
Sequence:CCGGGCTGTGAAGATGAAAGCATTACTCGAGTAATGCTTTCATCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017996.2-1806s1c1
Sequence:CCGGGAGTATGTTGTCAACTTCCATCTCGAGATGGAAGTTGACAACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017996.3-1294s21c1
Sequence:CCGGGATCCATCACAGGCATCTTTCCTCGAGGAAAGATGCCTGTGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017996.3-397s21c1
Sequence:CCGGCCTTGTTTCTTGCGTAAATTCCTCGAGGAATTTACGCAAGAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017996.2-1464s1c1
Sequence:CCGGCGGTTCAAAGACACTATTATACTCGAGTATAATAGTGTCTTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017996.2-1082s1c1
Sequence:CCGGACACCGGTTGCTGGTATATTTCTCGAGAAATATACCAGCAACCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017996
DET1 MISSION shRNA shRNA Plasmid DNA
de-etiolated homolog 1 (Arabidopsis)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178955    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017996.2-1862s1c1
Sequence:CCGGCCAGATTATCTGGTCTTCCAACTCGAGTTGGAAGACCAGATAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150230    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017996.2-2135s1c1
Sequence:CCGGGCTGTGAAGATGAAAGCATTACTCGAGTAATGCTTTCATCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017996.2-1806s1c1
Sequence:CCGGGAGTATGTTGTCAACTTCCATCTCGAGATGGAAGTTGACAACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017996.3-1294s21c1
Sequence:CCGGGATCCATCACAGGCATCTTTCCTCGAGGAAAGATGCCTGTGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017996.3-397s21c1
Sequence:CCGGCCTTGTTTCTTGCGTAAATTCCTCGAGGAATTTACGCAAGAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017996.2-1464s1c1
Sequence:CCGGCGGTTCAAAGACACTATTATACTCGAGTATAATAGTGTCTTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017996.2-1082s1c1
Sequence:CCGGACACCGGTTGCTGGTATATTTCTCGAGAAATATACCAGCAACCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017996
DET1 MISSION shRNA Lentiviral Transduction Particles
de-etiolated homolog 1 (Arabidopsis)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178955    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017996.2-1862s1c1
Sequence:CCGGCCAGATTATCTGGTCTTCCAACTCGAGTTGGAAGACCAGATAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150230    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017996.2-2135s1c1
Sequence:CCGGGCTGTGAAGATGAAAGCATTACTCGAGTAATGCTTTCATCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017996.2-1806s1c1
Sequence:CCGGGAGTATGTTGTCAACTTCCATCTCGAGATGGAAGTTGACAACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017996.3-1294s21c1
Sequence:CCGGGATCCATCACAGGCATCTTTCCTCGAGGAAAGATGCCTGTGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017996.3-397s21c1
Sequence:CCGGCCTTGTTTCTTGCGTAAATTCCTCGAGGAATTTACGCAAGAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017996.2-1464s1c1
Sequence:CCGGCGGTTCAAAGACACTATTATACTCGAGTATAATAGTGTCTTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017996.2-1082s1c1
Sequence:CCGGACACCGGTTGCTGGTATATTTCTCGAGAAATATACCAGCAACCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029585
VALIDATED
DET1 MISSION shRNA Bacterial Glycerol Stock
de-etiolated homolog 1 (Arabidopsis)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029585.2-288s1c1
Sequence:CCGGCTCCTTGTTTCTTACGGAAATCTCGAGATTTCCGTAAGAAACAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029585.2-349s1c1
Sequence:CCGGCCAGACATCTCTTGAAATCTACTCGAGTAGATTTCAAGAGATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029585.3-1385s1c1
Sequence:CCGGCGGTTCAAAGACACGATTATACTCGAGTATAATCGTGTCTTTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029585.3-1385s21c1
Sequence:CCGGCGGTTCAAAGACACGATTATACTCGAGTATAATCGTGTCTTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029585.3-1809s21c1
Sequence:CCGGCTTCGCTCAGTGGGCAATAAACTCGAGTTTATTGCCCACTGAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029585.3-289s21c1
Sequence:CCGGTCCTTGTTTCTTACGGAAATTCTCGAGAATTTCCGTAAGAAACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029585.3-1065s21c1
Sequence:CCGGGGCGGTTCTTCCAGTACTTTGCTCGAGCAAAGTACTGGAAGAACCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029585.3-771s21c1
Sequence:CCGGATCAAGGGCTCTACTTGTATACTCGAGTATACAAGTAGAGCCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029585
VALIDATED
DET1 MISSION shRNA shRNA Plasmid DNA
de-etiolated homolog 1 (Arabidopsis)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029585.2-288s1c1
Sequence:CCGGCTCCTTGTTTCTTACGGAAATCTCGAGATTTCCGTAAGAAACAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029585.2-349s1c1
Sequence:CCGGCCAGACATCTCTTGAAATCTACTCGAGTAGATTTCAAGAGATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029585.3-1385s1c1
Sequence:CCGGCGGTTCAAAGACACGATTATACTCGAGTATAATCGTGTCTTTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029585.3-1385s21c1
Sequence:CCGGCGGTTCAAAGACACGATTATACTCGAGTATAATCGTGTCTTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029585.3-1809s21c1
Sequence:CCGGCTTCGCTCAGTGGGCAATAAACTCGAGTTTATTGCCCACTGAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029585.3-289s21c1
Sequence:CCGGTCCTTGTTTCTTACGGAAATTCTCGAGAATTTCCGTAAGAAACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029585.3-1065s21c1
Sequence:CCGGGGCGGTTCTTCCAGTACTTTGCTCGAGCAAAGTACTGGAAGAACCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029585.3-771s21c1
Sequence:CCGGATCAAGGGCTCTACTTGTATACTCGAGTATACAAGTAGAGCCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029585
VALIDATED
DET1 MISSION shRNA Lentiviral Transduction Particles
de-etiolated homolog 1 (Arabidopsis)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029585.2-288s1c1
Sequence:CCGGCTCCTTGTTTCTTACGGAAATCTCGAGATTTCCGTAAGAAACAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029585.2-349s1c1
Sequence:CCGGCCAGACATCTCTTGAAATCTACTCGAGTAGATTTCAAGAGATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029585.3-1385s1c1
Sequence:CCGGCGGTTCAAAGACACGATTATACTCGAGTATAATCGTGTCTTTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029585.3-1385s21c1
Sequence:CCGGCGGTTCAAAGACACGATTATACTCGAGTATAATCGTGTCTTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029585.3-1809s21c1
Sequence:CCGGCTTCGCTCAGTGGGCAATAAACTCGAGTTTATTGCCCACTGAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029585.3-289s21c1
Sequence:CCGGTCCTTGTTTCTTACGGAAATTCTCGAGAATTTCCGTAAGAAACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029585.3-1065s21c1
Sequence:CCGGGGCGGTTCTTCCAGTACTTTGCTCGAGCAAAGTACTGGAAGAACCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029585.3-771s21c1
Sequence:CCGGATCAAGGGCTCTACTTGTATACTCGAGTATACAAGTAGAGCCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks