EMAIL THIS PAGE TO A FRIEND

DEXI

Dexi homolog (mouse)

Synonyms: MYLE
UniProtKB ID: O95424, B2RAA7
Gene ID:
Mouse(58239) dexamethasone-induced transcript
Rat(497857) dexamethasone-induced transcript
Zebrafish(445307) dexamethasone-induced transcript
chicken(771742) Dexi homolog (mouse)
domestic cat(101087121) Dexi homolog (mouse)
cow(782581) Dexi homolog (mouse)
dog(609975) Dexi homolog (mouse)
sheep(101106819) Dexi homolog (mouse)
naked mole-rat(101720528) Dexi homolog (mouse)
domestic guinea pig(100728371) Dexi homolog (mouse)
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014015 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU070241 MISSION® esiRNA esiRNA targeting mouse Dexi (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014015 Rosetta Predictions human pricing
NM_001109026 Rosetta Predictions rat pricing
NM_021428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166817 predicted 561
2 SASI_Hs02_00344986 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244444 predicted 955
2 SASI_Rn02_00244445 predicted 622
3 SASI_Rn02_00244446 predicted 933
4 SASI_Rn02_00244447 predicted 945
5 SASI_Rn02_00244448 predicted 582
6 SASI_Rn02_00244449 predicted 1130
7 SASI_Rn02_00244450 predicted 653
8 SASI_Rn02_00244451 predicted 517
9 SASI_Rn02_00244452 predicted 1066
10 SASI_Rn02_00244453 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126313 predicted 595
2 SASI_Mm01_00126315 predicted 491
3 SASI_Mm01_00126316 predicted 451
4 SASI_Mm01_00126317 predicted 1130
5 SASI_Mm02_00326065 predicted 1025
6 SASI_Mm01_00126318 predicted 633
7 SASI_Mm01_00126319 predicted 905
8 SASI_Mm01_00126320 predicted 614
9 SASI_Mm01_00126321 predicted 500
10 SASI_Mm01_00126322 predicted 1133
11 SASI_Mm01_00126314 predicted 1063
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021428
VALIDATED
DEXI MISSION shRNA Bacterial Glycerol Stock
Dexi homolog (mouse)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021428.4-631s21c1
Sequence:CCGGCTTCGATGGATATTTGGAATACTCGAGTATTCCAAATATCCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021428.4-478s21c1
Sequence:CCGGGCTGATCCTTTACTACGCCTTCTCGAGAAGGCGTAGTAAAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021428.4-938s21c1
Sequence:CCGGGCCACCTTTGTGATGGATGTTCTCGAGAACATCCATCACAAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021428.4-622s21c1
Sequence:CCGGGCTTGACGTCTTCGATGGATACTCGAGTATCCATCGAAGACGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021428.4-493s21c1
Sequence:CCGGCGCCTTCCTTATGGAATACATCTCGAGATGTATTCCATAAGGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-465s1c1
Sequence:CCGGGCTGATCCTTTACTACGCCTTCTCGAGAAGGCGTAGTAAAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-480s1c1
Sequence:CCGGCGCCTTCCTTATGGAATACATCTCGAGATGTATTCCATAAGGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-925s1c1
Sequence:CCGGGCCACCTTTGTGATGGATGTTCTCGAGAACATCCATCACAAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-618s1c1
Sequence:CCGGCTTCGATGGATATTTGGAATACTCGAGTATTCCAAATATCCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-609s1c1
Sequence:CCGGGCTTGACGTCTTCGATGGATACTCGAGTATCCATCGAAGACGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021428
VALIDATED
DEXI MISSION shRNA shRNA Plasmid DNA
Dexi homolog (mouse)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021428.4-631s21c1
Sequence:CCGGCTTCGATGGATATTTGGAATACTCGAGTATTCCAAATATCCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021428.4-478s21c1
Sequence:CCGGGCTGATCCTTTACTACGCCTTCTCGAGAAGGCGTAGTAAAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021428.4-938s21c1
Sequence:CCGGGCCACCTTTGTGATGGATGTTCTCGAGAACATCCATCACAAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021428.4-622s21c1
Sequence:CCGGGCTTGACGTCTTCGATGGATACTCGAGTATCCATCGAAGACGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021428.4-493s21c1
Sequence:CCGGCGCCTTCCTTATGGAATACATCTCGAGATGTATTCCATAAGGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-465s1c1
Sequence:CCGGGCTGATCCTTTACTACGCCTTCTCGAGAAGGCGTAGTAAAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-480s1c1
Sequence:CCGGCGCCTTCCTTATGGAATACATCTCGAGATGTATTCCATAAGGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-925s1c1
Sequence:CCGGGCCACCTTTGTGATGGATGTTCTCGAGAACATCCATCACAAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-618s1c1
Sequence:CCGGCTTCGATGGATATTTGGAATACTCGAGTATTCCAAATATCCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-609s1c1
Sequence:CCGGGCTTGACGTCTTCGATGGATACTCGAGTATCCATCGAAGACGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021428
VALIDATED
DEXI MISSION shRNA Lentiviral Transduction Particles
Dexi homolog (mouse)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021428.4-631s21c1
Sequence:CCGGCTTCGATGGATATTTGGAATACTCGAGTATTCCAAATATCCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021428.4-478s21c1
Sequence:CCGGGCTGATCCTTTACTACGCCTTCTCGAGAAGGCGTAGTAAAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021428.4-938s21c1
Sequence:CCGGGCCACCTTTGTGATGGATGTTCTCGAGAACATCCATCACAAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021428.4-622s21c1
Sequence:CCGGGCTTGACGTCTTCGATGGATACTCGAGTATCCATCGAAGACGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021428.4-493s21c1
Sequence:CCGGCGCCTTCCTTATGGAATACATCTCGAGATGTATTCCATAAGGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-465s1c1
Sequence:CCGGGCTGATCCTTTACTACGCCTTCTCGAGAAGGCGTAGTAAAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-480s1c1
Sequence:CCGGCGCCTTCCTTATGGAATACATCTCGAGATGTATTCCATAAGGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-925s1c1
Sequence:CCGGGCCACCTTTGTGATGGATGTTCTCGAGAACATCCATCACAAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-618s1c1
Sequence:CCGGCTTCGATGGATATTTGGAATACTCGAGTATTCCAAATATCCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021428.3-609s1c1
Sequence:CCGGGCTTGACGTCTTCGATGGATACTCGAGTATCCATCGAAGACGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014015
VALIDATED
DEXI MISSION shRNA Bacterial Glycerol Stock
Dexi homolog (mouse)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014015.3-1310s21c1
Sequence:CCGGCATTTCAGGTTACTCGTTCTTCTCGAGAAGAACGAGTAACCTGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014015.3-494s21c1
Sequence:CCGGGTTCTTCGTCAATGTGCTGATCTCGAGATCAGCACATTGACGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014015.3-533s21c1
Sequence:CCGGCATGGAGTACATCGTCCTCAACTCGAGTTGAGGACGATGTACTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014015.3-465s21c1
Sequence:CCGGCTGCTGCCCTCTATGTTCTACCTCGAGGTAGAACATAGAGGGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014015.3-656s21c1
Sequence:CCGGCGACGTCTTTGATGCGTACTTCTCGAGAAGTACGCATCAAAGACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014015.3-494s1c1
Sequence:CCGGGTTCTTCGTCAATGTGCTGATCTCGAGATCAGCACATTGACGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014015.3-1306s1c1
Sequence:CCGGCCTTCATTTCAGGTTACTCGTCTCGAGACGAGTAACCTGAAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014015.3-491s1c1
Sequence:CCGGCCTGTTCTTCGTCAATGTGCTCTCGAGAGCACATTGACGAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014015.3-1310s1c1
Sequence:CCGGCATTTCAGGTTACTCGTTCTTCTCGAGAAGAACGAGTAACCTGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014015.3-1303s1c1
Sequence:CCGGGCTCCTTCATTTCAGGTTACTCTCGAGAGTAACCTGAAATGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014015
VALIDATED
DEXI MISSION shRNA shRNA Plasmid DNA
Dexi homolog (mouse)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014015.3-1310s21c1
Sequence:CCGGCATTTCAGGTTACTCGTTCTTCTCGAGAAGAACGAGTAACCTGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014015.3-494s21c1
Sequence:CCGGGTTCTTCGTCAATGTGCTGATCTCGAGATCAGCACATTGACGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014015.3-533s21c1
Sequence:CCGGCATGGAGTACATCGTCCTCAACTCGAGTTGAGGACGATGTACTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014015.3-465s21c1
Sequence:CCGGCTGCTGCCCTCTATGTTCTACCTCGAGGTAGAACATAGAGGGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014015.3-656s21c1
Sequence:CCGGCGACGTCTTTGATGCGTACTTCTCGAGAAGTACGCATCAAAGACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014015.3-494s1c1
Sequence:CCGGGTTCTTCGTCAATGTGCTGATCTCGAGATCAGCACATTGACGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014015.3-1306s1c1
Sequence:CCGGCCTTCATTTCAGGTTACTCGTCTCGAGACGAGTAACCTGAAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014015.3-491s1c1
Sequence:CCGGCCTGTTCTTCGTCAATGTGCTCTCGAGAGCACATTGACGAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014015.3-1310s1c1
Sequence:CCGGCATTTCAGGTTACTCGTTCTTCTCGAGAAGAACGAGTAACCTGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014015.3-1303s1c1
Sequence:CCGGGCTCCTTCATTTCAGGTTACTCTCGAGAGTAACCTGAAATGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014015
VALIDATED
DEXI MISSION shRNA Lentiviral Transduction Particles
Dexi homolog (mouse)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014015.3-1310s21c1
Sequence:CCGGCATTTCAGGTTACTCGTTCTTCTCGAGAAGAACGAGTAACCTGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014015.3-494s21c1
Sequence:CCGGGTTCTTCGTCAATGTGCTGATCTCGAGATCAGCACATTGACGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014015.3-533s21c1
Sequence:CCGGCATGGAGTACATCGTCCTCAACTCGAGTTGAGGACGATGTACTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014015.3-465s21c1
Sequence:CCGGCTGCTGCCCTCTATGTTCTACCTCGAGGTAGAACATAGAGGGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014015.3-656s21c1
Sequence:CCGGCGACGTCTTTGATGCGTACTTCTCGAGAAGTACGCATCAAAGACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014015.3-494s1c1
Sequence:CCGGGTTCTTCGTCAATGTGCTGATCTCGAGATCAGCACATTGACGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014015.3-1306s1c1
Sequence:CCGGCCTTCATTTCAGGTTACTCGTCTCGAGACGAGTAACCTGAAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014015.3-491s1c1
Sequence:CCGGCCTGTTCTTCGTCAATGTGCTCTCGAGAGCACATTGACGAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014015.3-1310s1c1
Sequence:CCGGCATTTCAGGTTACTCGTTCTTCTCGAGAAGAACGAGTAACCTGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014015.3-1303s1c1
Sequence:CCGGGCTCCTTCATTTCAGGTTACTCTCGAGAGTAACCTGAAATGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks