EMAIL THIS PAGE TO A FRIEND

DFFA

DNA fragmentation factor, 45kDa, alpha polypeptide

113 Gene Product Result for
Synonyms: DFF-45 DFF1 ICAD
UniProtKB ID: O00273, Q5T6G5, Q5T6G6, Q96I97, Q9Y6C6
Gene ID:
Human(1676) Summary: Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(13347) DNA fragmentation factor, alpha subunit
Rat(114214) DNA fragmentation factor, alpha subunit
Zebrafish(436904) DNA fragmentation factor, alpha polypeptide
cow(507981) DNA fragmentation factor, 45kDa, alpha polypeptide
domestic cat(101096745) DNA fragmentation factor, 45kDa, alpha polypeptide
dog(487449) DNA fragmentation factor, 45kDa, alpha polypeptide
chicken(419451) DNA fragmentation factor, 45kDa, alpha polypeptide
domestic guinea pig(100719233) DNA fragmentation factor, 45kDa, alpha polypeptide
naked mole-rat(101700734) DNA fragmentation factor, 45kDa, alpha polypeptide
sheep(101114715) DNA fragmentation factor, 45kDa, alpha polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3501109 Anti-DFF45 antibody produced in rabbit purified antibody (DEAE) human
ELISA, western blot pricing
I7653 Anti-DFF45, C-Terminal antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
D3313 Anti-DFF45, C-Terminal antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
I7528 Anti-DFF45, N-Terminal antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
D3438 Anti-DFF45, N-Terminal antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405710 Anti-DFFA antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV30359 Anti-DFFA antibody produced in rabbit IgG fraction of antiserum bovine, human, canine, horse, mouse, rat, guinea pig
western blot pricing
HPA025230 Anti-DFFA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab3 human
immunohistochemistry, western blot pricing
HPA018859 Anti-DFFA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunohistochemistry pricing
HPA019938 Anti-DFFA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry, western blot pricing
SAB4500644 Anti-DFFA antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
PRS2001 Anti-ICAD antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS2003 Anti-ICAD antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4200199 Monoclonal Anti-DFF45 antibody produced in mouse ~1.0 mg/mL, clone 3F12, purified immunoglobulin human
western blot pricing
SAB4100013 Monoclonal Anti-DFFA antibody produced in mouse culture supernatant human
western blot pricing
SAB1402172 Monoclonal Anti-DFFA, (C-terminal) antibody produced in mouse clone 3A11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025296 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025296 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025296 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004401 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004401 Rosetta Predictions human pricing
NM_213566 Rosetta Predictions human pricing
NM_053679 Rosetta Predictions rat pricing
NM_001025296 Rosetta Predictions mouse pricing
NM_010044 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181291 predicted 505
2 SASI_Hs01_00181292 predicted 315
3 SASI_Hs01_00181293 predicted 342
4 SASI_Hs01_00181294 predicted 221
5 SASI_Hs01_00181295 predicted 615
6 SASI_Hs01_00181296 predicted 347
7 SASI_Hs02_00337525 predicted 220
8 SASI_Hs01_00181297 predicted 492
9 SASI_Hs01_00181298 predicted 617
10 SASI_Hs01_00181300 predicted 243
11 SASI_Hs01_00181299 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048030 predicted 502
2 SASI_Hs01_00048031 predicted 314
3 SASI_Hs01_00048032 predicted 343
4 SASI_Hs01_00048033 predicted 221
5 SASI_Hs01_00048034 predicted 616
6 SASI_Hs01_00048035 predicted 352
7 SASI_Hs02_00374257 predicted 219
8 SASI_Hs01_00048036 predicted 487
9 SASI_Hs01_00048037 predicted 618
10 SASI_Hs01_00048039 predicted 240
11 SASI_Hs01_00048038 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075132 predicted 1283
2 SASI_Rn01_00075133 predicted 1209
3 SASI_Rn01_00075134 predicted 206
4 SASI_Rn01_00075135 predicted 961
5 SASI_Rn02_00266420 predicted 485
6 SASI_Rn01_00075136 predicted 995
7 SASI_Rn01_00075137 predicted 992
8 SASI_Rn01_00075138 predicted 878
9 SASI_Rn01_00075139 predicted 839
10 SASI_Rn01_00075140 predicted 914
11 SASI_Rn01_00075141 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039911 predicted 230
2 SASI_Mm02_00287824 predicted 506
3 SASI_Mm01_00039912 predicted 376
4 SASI_Mm01_00039913 predicted 360
5 SASI_Mm01_00039914 predicted 361
6 SASI_Mm01_00039915 predicted 417
7 SASI_Mm01_00039916 predicted 289
8 SASI_Mm01_00039917 predicted 635
9 SASI_Mm01_00039918 predicted 233
10 SASI_Mm01_00039919 predicted 358
11 SASI_Mm01_00039920 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197540 predicted 230
2 SASI_Mm02_00317681 predicted 500
3 SASI_Mm01_00197541 predicted 373
4 SASI_Mm01_00197542 predicted 354
5 SASI_Mm01_00197543 predicted 361
6 SASI_Mm01_00197544 predicted 416
7 SASI_Mm01_00197545 predicted 291
8 SASI_Mm01_00197546 predicted 642
9 SASI_Mm01_00197547 predicted 236
10 SASI_Mm01_00197548 predicted 364
11 SASI_Mm01_00197549 predicted 580
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025296
DFFA MISSION shRNA Bacterial Glycerol Stock
DNA fragmentation factor, 45kDa, alpha polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025296.1-367s1c1
Sequence:CCGGGCAATGAGAAGTGGATTTATACTCGAGTATAAATCCACTTCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025296.1-1636s1c1
Sequence:CCGGGCCATGAACTTCTCAAGCTAACTCGAGTTAGCTTGAGAAGTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025296.1-332s1c1
Sequence:CCGGCCTTCCTTCCAATACGAAGTTCTCGAGAACTTCGTATTGGAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025296.1-856s1c1
Sequence:CCGGTGAGTTTATCTAGTCAGGATTCTCGAGAATCCTGACTAGATAAACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025296.1-1001s1c1
Sequence:CCGGGAGCTTGCATTCACTCAGGAACTCGAGTTCCTGAGTGAATGCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025296
DFFA MISSION shRNA shRNA Plasmid DNA
DNA fragmentation factor, 45kDa, alpha polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025296.1-367s1c1
Sequence:CCGGGCAATGAGAAGTGGATTTATACTCGAGTATAAATCCACTTCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025296.1-1636s1c1
Sequence:CCGGGCCATGAACTTCTCAAGCTAACTCGAGTTAGCTTGAGAAGTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025296.1-332s1c1
Sequence:CCGGCCTTCCTTCCAATACGAAGTTCTCGAGAACTTCGTATTGGAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025296.1-856s1c1
Sequence:CCGGTGAGTTTATCTAGTCAGGATTCTCGAGAATCCTGACTAGATAAACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025296.1-1001s1c1
Sequence:CCGGGAGCTTGCATTCACTCAGGAACTCGAGTTCCTGAGTGAATGCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025296
DFFA MISSION shRNA Lentiviral Transduction Particles
DNA fragmentation factor, 45kDa, alpha polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025296.1-367s1c1
Sequence:CCGGGCAATGAGAAGTGGATTTATACTCGAGTATAAATCCACTTCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025296.1-1636s1c1
Sequence:CCGGGCCATGAACTTCTCAAGCTAACTCGAGTTAGCTTGAGAAGTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025296.1-332s1c1
Sequence:CCGGCCTTCCTTCCAATACGAAGTTCTCGAGAACTTCGTATTGGAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025296.1-856s1c1
Sequence:CCGGTGAGTTTATCTAGTCAGGATTCTCGAGAATCCTGACTAGATAAACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025296.1-1001s1c1
Sequence:CCGGGAGCTTGCATTCACTCAGGAACTCGAGTTCCTGAGTGAATGCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004401
VALIDATED
DFFA MISSION shRNA Bacterial Glycerol Stock
DNA fragmentation factor, 45kDa, alpha polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004401.x-875s1c1
Sequence:CCGGTGCCTTGAACTGGGACATAAACTCGAGTTTATGTCCCAGTTCAAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004401.x-336s1c1
Sequence:CCGGTGGGCATACAACAATTCAGATCTCGAGATCTGAATTGTTGTATGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004401.x-264s1c1
Sequence:CCGGGTGGATGATGACGATTACTTTCTCGAGAAAGTAATCGTCATCATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004401.x-1084s1c1
Sequence:CCGGTGGCGTTGTGTTATTGGTAGACTCGAGTCTACCAATAACACAACGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004401.2-134s21c1
Sequence:CCGGTGGCGAGATCCGGACTCTAAACTCGAGTTTAGAGTCCGGATCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004401.2-351s21c1
Sequence:CCGGTTTGTGGCATTGGCTAGTAATCTCGAGATTACTAGCCAATGCCACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004401.2-1126s21c1
Sequence:CCGGTGGCGTTGTGTTATTGGTAGACTCGAGTCTACCAATAACACAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004401.2-917s21c1
Sequence:CCGGTGCCTTGAACTGGGACATAAACTCGAGTTTATGTCCCAGTTCAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004401.2-306s21c1
Sequence:CCGGGTGGATGATGACGATTACTTTCTCGAGAAAGTAATCGTCATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004401
VALIDATED
DFFA MISSION shRNA shRNA Plasmid DNA
DNA fragmentation factor, 45kDa, alpha polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004401.x-875s1c1
Sequence:CCGGTGCCTTGAACTGGGACATAAACTCGAGTTTATGTCCCAGTTCAAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004401.x-336s1c1
Sequence:CCGGTGGGCATACAACAATTCAGATCTCGAGATCTGAATTGTTGTATGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004401.x-264s1c1
Sequence:CCGGGTGGATGATGACGATTACTTTCTCGAGAAAGTAATCGTCATCATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004401.x-1084s1c1
Sequence:CCGGTGGCGTTGTGTTATTGGTAGACTCGAGTCTACCAATAACACAACGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004401.2-134s21c1
Sequence:CCGGTGGCGAGATCCGGACTCTAAACTCGAGTTTAGAGTCCGGATCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004401.2-351s21c1
Sequence:CCGGTTTGTGGCATTGGCTAGTAATCTCGAGATTACTAGCCAATGCCACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004401.2-1126s21c1
Sequence:CCGGTGGCGTTGTGTTATTGGTAGACTCGAGTCTACCAATAACACAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004401.2-917s21c1
Sequence:CCGGTGCCTTGAACTGGGACATAAACTCGAGTTTATGTCCCAGTTCAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004401.2-306s21c1
Sequence:CCGGGTGGATGATGACGATTACTTTCTCGAGAAAGTAATCGTCATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004401
VALIDATED
DFFA MISSION shRNA Lentiviral Transduction Particles
DNA fragmentation factor, 45kDa, alpha polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004401.x-875s1c1
Sequence:CCGGTGCCTTGAACTGGGACATAAACTCGAGTTTATGTCCCAGTTCAAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004401.x-336s1c1
Sequence:CCGGTGGGCATACAACAATTCAGATCTCGAGATCTGAATTGTTGTATGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004401.x-264s1c1
Sequence:CCGGGTGGATGATGACGATTACTTTCTCGAGAAAGTAATCGTCATCATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004401.x-1084s1c1
Sequence:CCGGTGGCGTTGTGTTATTGGTAGACTCGAGTCTACCAATAACACAACGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004401.2-134s21c1
Sequence:CCGGTGGCGAGATCCGGACTCTAAACTCGAGTTTAGAGTCCGGATCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004401.2-351s21c1
Sequence:CCGGTTTGTGGCATTGGCTAGTAATCTCGAGATTACTAGCCAATGCCACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004401.2-1126s21c1
Sequence:CCGGTGGCGTTGTGTTATTGGTAGACTCGAGTCTACCAATAACACAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004401.2-917s21c1
Sequence:CCGGTGCCTTGAACTGGGACATAAACTCGAGTTTATGTCCCAGTTCAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004401.2-306s21c1
Sequence:CCGGGTGGATGATGACGATTACTTTCTCGAGAAAGTAATCGTCATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks