EMAIL THIS PAGE TO A FRIEND

DFFB

DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)

97 Gene Product Result for
Synonyms: CAD CPAN DFF-40 DFF2 DFF40
UniProtKB ID: O76075, O60521, Q5SR22, Q9BYI4, Q9BYI5, Q9BYI6
Gene ID:
Human(1677) Summary: Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(13368) DNA fragmentation factor, beta subunit
Rat(84359) DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
sheep(101101905) DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
naked mole-rat(101713910) DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
domestic guinea pig(100713108) DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
Zebrafish(373130) DNA fragmentation factor, beta polypeptide (caspase-activated DNase)
cow(512730) DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
domestic cat(101092127) DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
dog(489623) DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
chicken(374158) DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004402 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004285 Rosetta Predictions human pricing
NM_001004286 Rosetta Predictions human pricing
NM_004402 Rosetta Predictions human pricing
NM_053362 Rosetta Predictions rat pricing
NM_007859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052788 predicted 820
2 SASI_Hs01_00052789 predicted 832
3 SASI_Hs01_00052790 predicted 856
4 SASI_Hs01_00052791 predicted 834
5 SASI_Hs01_00052792 predicted 977
6 SASI_Hs01_00052793 predicted 1054
7 SASI_Hs01_00052794 predicted 1351
8 SASI_Hs01_00052795 predicted 1219
9 SASI_Hs01_00052796 predicted 1993
10 SASI_Hs01_00052797 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176320 predicted 799
2 SASI_Hs01_00176321 predicted 808
3 SASI_Hs01_00176322 predicted 826
4 SASI_Hs01_00176323 predicted 810
5 SASI_Hs01_00176324 predicted 1110
6 SASI_Hs01_00176325 predicted 944
7 SASI_Hs01_00176326 predicted 1143
8 SASI_Hs01_00176327 predicted 1151
9 SASI_Hs01_00176328 predicted 1111
10 SASI_Hs01_00176329 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124226 predicted 1125
2 SASI_Hs01_00124218 predicted 1159
3 SASI_Hs02_00337526 predicted 584
4 SASI_Hs02_00337527 predicted 1086
5 SASI_Hs01_00124221 predicted 778
6 SASI_Hs01_00124222 predicted 1163
7 SASI_Hs02_00337528 predicted 746
8 SASI_Hs01_00124223 predicted 1085
9 SASI_Hs02_00337529 predicted 481
10 SASI_Hs02_00337530 predicted 1111
11 SASI_Hs01_00124217 predicted 776
12 SASI_Hs01_00124219 predicted 785
13 SASI_Hs01_00124220 predicted 798
14 SASI_Hs01_00124224 predicted 922
15 SASI_Hs01_00124225 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058468 predicted 391
2 SASI_Rn01_00058469 predicted 783
3 SASI_Rn01_00058470 predicted 531
4 SASI_Rn01_00058471 predicted 256
5 SASI_Rn01_00058472 predicted 872
6 SASI_Rn01_00058473 predicted 914
7 SASI_Rn02_00265836 predicted 762
8 SASI_Rn01_00058475 predicted 897
9 SASI_Rn01_00058476 predicted 444
10 SASI_Rn01_00058477 predicted 273
11 SASI_Rn01_00058474 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037604 predicted 356
2 SASI_Mm01_00037605 predicted 1324
3 SASI_Mm01_00037606 predicted 1242
4 SASI_Mm01_00037607 predicted 1410
5 SASI_Mm01_00037608 predicted 1276
6 SASI_Mm02_00312632 predicted 779
7 SASI_Mm01_00037610 predicted 543
8 SASI_Mm02_00312633 predicted 562
9 SASI_Mm01_00037611 predicted 1053
10 SASI_Mm01_00037612 predicted 1290
11 SASI_Mm01_00037609 predicted 393
12 SASI_Mm01_00037613 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004402
DFFB MISSION shRNA Bacterial Glycerol Stock
DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004402.2-1471s21c1
Sequence:CCGGTGTTTCCTCCAAATCTGATTTCTCGAGAAATCAGATTTGGAGGAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004402.2-750s21c1
Sequence:CCGGGAAGGCTTGGAGTCCCGATTTCTCGAGAAATCGGGACTCCAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004402.2-1134s21c1
Sequence:CCGGACACTGGTGGAAGCAATTAAGCTCGAGCTTAATTGCTTCCACCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004402.2-1013s21c1
Sequence:CCGGTGACATGGACAGCTGCTTATCCTCGAGGATAAGCAGCTGTCCATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004402.x-500s1c1
Sequence:CCGGGCACAACGTCAGCCAGAACATCTCGAGATGTTCTGGCTGACGTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004402.x-719s1c1
Sequence:CCGGGCTCCGGTCCATGCAGTACAACTCGAGTTGTACTGCATGGACCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004402.x-287s1c1
Sequence:CCGGCACGGAGCTGACGGAAGATTACTCGAGTAATCTTCCGTCAGCTCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004402.x-894s1c1
Sequence:CCGGACCTGGAACCTGGATCACATACTCGAGTATGTGATCCAGGTTCCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004402.x-1741s1c1
Sequence:CCGGGCGTTGGGTTTGCTCATGTAACTCGAGTTACATGAGCAAACCCAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004402
DFFB MISSION shRNA shRNA Plasmid DNA
DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004402.2-1471s21c1
Sequence:CCGGTGTTTCCTCCAAATCTGATTTCTCGAGAAATCAGATTTGGAGGAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004402.2-750s21c1
Sequence:CCGGGAAGGCTTGGAGTCCCGATTTCTCGAGAAATCGGGACTCCAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004402.2-1134s21c1
Sequence:CCGGACACTGGTGGAAGCAATTAAGCTCGAGCTTAATTGCTTCCACCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004402.2-1013s21c1
Sequence:CCGGTGACATGGACAGCTGCTTATCCTCGAGGATAAGCAGCTGTCCATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004402.x-500s1c1
Sequence:CCGGGCACAACGTCAGCCAGAACATCTCGAGATGTTCTGGCTGACGTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004402.x-719s1c1
Sequence:CCGGGCTCCGGTCCATGCAGTACAACTCGAGTTGTACTGCATGGACCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004402.x-287s1c1
Sequence:CCGGCACGGAGCTGACGGAAGATTACTCGAGTAATCTTCCGTCAGCTCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004402.x-894s1c1
Sequence:CCGGACCTGGAACCTGGATCACATACTCGAGTATGTGATCCAGGTTCCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004402.x-1741s1c1
Sequence:CCGGGCGTTGGGTTTGCTCATGTAACTCGAGTTACATGAGCAAACCCAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004402
DFFB MISSION shRNA Lentiviral Transduction Particles
DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004402.2-1471s21c1
Sequence:CCGGTGTTTCCTCCAAATCTGATTTCTCGAGAAATCAGATTTGGAGGAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004402.2-750s21c1
Sequence:CCGGGAAGGCTTGGAGTCCCGATTTCTCGAGAAATCGGGACTCCAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004402.2-1134s21c1
Sequence:CCGGACACTGGTGGAAGCAATTAAGCTCGAGCTTAATTGCTTCCACCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004402.2-1013s21c1
Sequence:CCGGTGACATGGACAGCTGCTTATCCTCGAGGATAAGCAGCTGTCCATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004402.x-500s1c1
Sequence:CCGGGCACAACGTCAGCCAGAACATCTCGAGATGTTCTGGCTGACGTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004402.x-719s1c1
Sequence:CCGGGCTCCGGTCCATGCAGTACAACTCGAGTTGTACTGCATGGACCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004402.x-287s1c1
Sequence:CCGGCACGGAGCTGACGGAAGATTACTCGAGTAATCTTCCGTCAGCTCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004402.x-894s1c1
Sequence:CCGGACCTGGAACCTGGATCACATACTCGAGTATGTGATCCAGGTTCCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004402.x-1741s1c1
Sequence:CCGGGCGTTGGGTTTGCTCATGTAACTCGAGTTACATGAGCAAACCCAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007859
VALIDATED
DFFB MISSION shRNA Bacterial Glycerol Stock
DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007859.4-125s21c1
Sequence:CCGGCAAGTTGCGAGCCCTACATAGCTCGAGCTATGTAGGGCTCGCAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007859.2-561s1c2
Sequence:CCGGCCCATCCTGGTTTGAAGGTTTCTCGAGAAACCTTCAAACCAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007859.2-454s1c2
Sequence:CCGGGCACGGCAACTGCTGTCAGATCTCGAGATCTGACAGCAGTTGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007859.2-1913s1c2
Sequence:CCGGGCTGGACTGGAGTTCACTATACTCGAGTATAGTGAACTCCAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007859.4-701s21c1
Sequence:CCGGGCAGTACAATGGCAGCTATTTCTCGAGAAATAGCTGCCATTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007859.4-1509s21c1
Sequence:CCGGCATGACTCAACACTGATATATCTCGAGATATATCAGTGTTGAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007859.4-471s21c1
Sequence:CCGGCATCACGTGAGCCAGAATATTCTCGAGAATATTCTGGCTCACGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007859.4-864s21c1
Sequence:CCGGACCTGGAACCTGGATCATATACTCGAGTATATGATCCAGGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007859.2-910s1c1
Sequence:CCGGACCTGGAACCTGGATCATATACTCGAGTATATGATCCAGGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007859.2-747s1c1
Sequence:CCGGGCAGTACAATGGCAGCTATTTCTCGAGAAATAGCTGCCATTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007859
VALIDATED
DFFB MISSION shRNA shRNA Plasmid DNA
DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007859.4-125s21c1
Sequence:CCGGCAAGTTGCGAGCCCTACATAGCTCGAGCTATGTAGGGCTCGCAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007859.2-561s1c2
Sequence:CCGGCCCATCCTGGTTTGAAGGTTTCTCGAGAAACCTTCAAACCAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007859.2-454s1c2
Sequence:CCGGGCACGGCAACTGCTGTCAGATCTCGAGATCTGACAGCAGTTGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007859.2-1913s1c2
Sequence:CCGGGCTGGACTGGAGTTCACTATACTCGAGTATAGTGAACTCCAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007859.4-701s21c1
Sequence:CCGGGCAGTACAATGGCAGCTATTTCTCGAGAAATAGCTGCCATTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007859.4-1509s21c1
Sequence:CCGGCATGACTCAACACTGATATATCTCGAGATATATCAGTGTTGAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007859.4-471s21c1
Sequence:CCGGCATCACGTGAGCCAGAATATTCTCGAGAATATTCTGGCTCACGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007859.4-864s21c1
Sequence:CCGGACCTGGAACCTGGATCATATACTCGAGTATATGATCCAGGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007859.2-910s1c1
Sequence:CCGGACCTGGAACCTGGATCATATACTCGAGTATATGATCCAGGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007859.2-747s1c1
Sequence:CCGGGCAGTACAATGGCAGCTATTTCTCGAGAAATAGCTGCCATTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007859
VALIDATED
DFFB MISSION shRNA Lentiviral Transduction Particles
DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007859.4-125s21c1
Sequence:CCGGCAAGTTGCGAGCCCTACATAGCTCGAGCTATGTAGGGCTCGCAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007859.2-561s1c2
Sequence:CCGGCCCATCCTGGTTTGAAGGTTTCTCGAGAAACCTTCAAACCAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007859.2-454s1c2
Sequence:CCGGGCACGGCAACTGCTGTCAGATCTCGAGATCTGACAGCAGTTGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007859.2-1913s1c2
Sequence:CCGGGCTGGACTGGAGTTCACTATACTCGAGTATAGTGAACTCCAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007859.4-701s21c1
Sequence:CCGGGCAGTACAATGGCAGCTATTTCTCGAGAAATAGCTGCCATTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007859.4-1509s21c1
Sequence:CCGGCATGACTCAACACTGATATATCTCGAGATATATCAGTGTTGAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007859.4-471s21c1
Sequence:CCGGCATCACGTGAGCCAGAATATTCTCGAGAATATTCTGGCTCACGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007859.4-864s21c1
Sequence:CCGGACCTGGAACCTGGATCATATACTCGAGTATATGATCCAGGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007859.2-910s1c1
Sequence:CCGGACCTGGAACCTGGATCATATACTCGAGTATATGATCCAGGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007859.2-747s1c1
Sequence:CCGGGCAGTACAATGGCAGCTATTTCTCGAGAAATAGCTGCCATTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks