EMAIL THIS PAGE TO A FRIEND

DFNA5

deafness, autosomal dominant 5

78 Gene Product Result for
Synonyms: ICERE-1
Gene ID:
Human(1687) Summary: Hearing impairment is a heterogeneous condition with over 40 loci described. The protein encoded by this gene is expressed in fetal cochlea, however, its function is not known. Nonsyndromic hearing impairment is associated with a mutation in this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(54722) deafness, autosomal dominant 5 (human)
Rat(353316) deafness, autosomal dominant 5 (human)
Zebrafish(335722) deafness, autosomal dominant 5
cow(616398) deafness, autosomal dominant 5
Horse(100033992) deafness, autosomal dominant 5
domestic cat(101081716) deafness, autosomal dominant 5
dog(611223) deafness, autosomal dominant 5
chicken(420623) deafness, autosomal dominant 5
domestic guinea pig(100728321) deafness, autosomal dominant 5
naked mole-rat(101720023) deafness, autosomal dominant 5
sheep(101109266) deafness, autosomal dominant 5
Domestic Rabbit(100351833) deafness, autosomal dominant 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004403 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127453 Rosetta Predictions human pricing
NM_001127454 Rosetta Predictions human pricing
NM_004403 Rosetta Predictions human pricing
XM_001056934 Rosetta Predictions rat pricing
XM_231759 Rosetta Predictions rat pricing
NM_018769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329554 predicted 1474
2 SASI_Hs02_00329555 predicted 1595
3 SASI_Hs02_00329556 predicted 1485
4 SASI_Hs02_00329557 predicted 737
5 SASI_Hs02_00329558 predicted 867
6 SASI_Hs02_00329559 predicted 860
7 SASI_Hs02_00329560 predicted 562
8 SASI_Hs02_00329561 predicted 1231
9 SASI_Hs02_00329562 predicted 1622
10 SASI_Hs02_00329563 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329564 predicted 1496
2 SASI_Hs02_00329565 predicted 1613
3 SASI_Hs02_00329566 predicted 1505
4 SASI_Hs02_00329567 predicted 761
5 SASI_Hs02_00329568 predicted 881
6 SASI_Hs02_00329569 predicted 877
7 SASI_Hs02_00329570 predicted 1241
8 SASI_Hs02_00329571 predicted 1637
9 SASI_Hs02_00329572 predicted 1421
10 SASI_Hs02_00329573 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162856 predicted 1719
2 SASI_Hs01_00162857 predicted 1847
3 SASI_Hs02_00337531 predicted 1732
4 SASI_Hs01_00162858 predicted 988
5 SASI_Hs01_00162860 predicted 1113
6 SASI_Hs02_00337532 predicted 1101
7 SASI_Hs01_00162861 predicted 802
8 SASI_Hs01_00162862 predicted 1476
9 SASI_Hs01_00162863 predicted 1872
10 SASI_Hs01_00162865 predicted 1645
11 SASI_Hs01_00162859 predicted 1245
12 SASI_Hs01_00162864 predicted 1642
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284909 predicted 1498
2 SASI_Rn02_00284910 predicted 1462
3 SASI_Rn02_00284911 predicted 1627
4 SASI_Rn02_00284912 predicted 1608
5 SASI_Rn02_00284913 predicted 1287
6 SASI_Rn02_00284914 predicted 597
7 SASI_Rn02_00284915 predicted 436
8 SASI_Rn02_00284916 predicted 330
9 SASI_Rn02_00284917 predicted 1260
10 SASI_Rn02_00284918 predicted 1582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386921 predicted 2058
2 SASI_Rn02_00386922 predicted 2054
3 SASI_Rn02_00386923 predicted 1906
4 SASI_Rn02_00386924 predicted 1964
5 SASI_Rn02_00386925 predicted 1960
6 SASI_Rn02_00386926 predicted 2063
7 SASI_Rn02_00386927 predicted 1525
8 SASI_Rn02_00386928 predicted 718
9 SASI_Rn02_00386929 predicted 1488
10 SASI_Rn02_00386930 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022605 predicted 1500
2 SASI_Mm02_00324079 predicted 840
3 SASI_Mm01_00022606 predicted 941
4 SASI_Mm01_00022608 predicted 279
5 SASI_Mm01_00022609 predicted 739
6 SASI_Mm01_00022611 predicted 457
7 SASI_Mm01_00022612 predicted 1535
8 SASI_Mm02_00324080 predicted 1206
9 SASI_Mm01_00022613 predicted 801
10 SASI_Mm01_00022614 predicted 1694
11 SASI_Mm01_00022607 predicted 1298
12 SASI_Mm01_00022610 predicted 1309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018769
VALIDATED
DFNA5 MISSION shRNA Bacterial Glycerol Stock
deafness, autosomal dominant 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018769.1-1710s1c1
Sequence:CCGGCGAGCGTTGTCAATGGGTTATCTCGAGATAACCCATTGACAACGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018769.1-459s1c1
Sequence:CCGGCCGTCAAGAGAACAGTTAATACTCGAGTATTAACTGTTCTCTTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018769.1-1802s1c1
Sequence:CCGGCCACTCTTATCTGATGTACAACTCGAGTTGTACATCAGATAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018769.1-731s1c1
Sequence:CCGGGAGCTGTTTGTGAAACAAGATCTCGAGATCTTGTTTCACAAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018769.1-1505s1c1
Sequence:CCGGCCGCTAATTCTTCACATCACTCTCGAGAGTGATGTGAAGAATTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018769.3-281s21c1
Sequence:CCGGTGGAGTCAGACTTCGTGAAATCTCGAGATTTCACGAAGTCTGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018769.3-1710s21c1
Sequence:CCGGGAGCGTTGTCAATGGGTTATTCTCGAGAATAACCCATTGACAACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018769.3-730s21c1
Sequence:CCGGGAGCTGTTTGTGAAACAAGATCTCGAGATCTTGTTTCACAAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018769.3-306s1c1
Sequence:CCGGGAGCAAGTGTGAGAACCATAACTCGAGTTATGGTTCTCACACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018769.3-458s21c1
Sequence:CCGGCCGTCAAGAGAACAGTTAATACTCGAGTATTAACTGTTCTCTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018769
VALIDATED
DFNA5 MISSION shRNA shRNA Plasmid DNA
deafness, autosomal dominant 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018769.1-1710s1c1
Sequence:CCGGCGAGCGTTGTCAATGGGTTATCTCGAGATAACCCATTGACAACGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018769.1-459s1c1
Sequence:CCGGCCGTCAAGAGAACAGTTAATACTCGAGTATTAACTGTTCTCTTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018769.1-1802s1c1
Sequence:CCGGCCACTCTTATCTGATGTACAACTCGAGTTGTACATCAGATAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018769.1-731s1c1
Sequence:CCGGGAGCTGTTTGTGAAACAAGATCTCGAGATCTTGTTTCACAAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018769.1-1505s1c1
Sequence:CCGGCCGCTAATTCTTCACATCACTCTCGAGAGTGATGTGAAGAATTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018769.3-281s21c1
Sequence:CCGGTGGAGTCAGACTTCGTGAAATCTCGAGATTTCACGAAGTCTGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018769.3-1710s21c1
Sequence:CCGGGAGCGTTGTCAATGGGTTATTCTCGAGAATAACCCATTGACAACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018769.3-730s21c1
Sequence:CCGGGAGCTGTTTGTGAAACAAGATCTCGAGATCTTGTTTCACAAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018769.3-306s1c1
Sequence:CCGGGAGCAAGTGTGAGAACCATAACTCGAGTTATGGTTCTCACACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018769.3-458s21c1
Sequence:CCGGCCGTCAAGAGAACAGTTAATACTCGAGTATTAACTGTTCTCTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018769
VALIDATED
DFNA5 MISSION shRNA Lentiviral Transduction Particles
deafness, autosomal dominant 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018769.1-1710s1c1
Sequence:CCGGCGAGCGTTGTCAATGGGTTATCTCGAGATAACCCATTGACAACGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018769.1-459s1c1
Sequence:CCGGCCGTCAAGAGAACAGTTAATACTCGAGTATTAACTGTTCTCTTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018769.1-1802s1c1
Sequence:CCGGCCACTCTTATCTGATGTACAACTCGAGTTGTACATCAGATAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018769.1-731s1c1
Sequence:CCGGGAGCTGTTTGTGAAACAAGATCTCGAGATCTTGTTTCACAAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018769.1-1505s1c1
Sequence:CCGGCCGCTAATTCTTCACATCACTCTCGAGAGTGATGTGAAGAATTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018769.3-281s21c1
Sequence:CCGGTGGAGTCAGACTTCGTGAAATCTCGAGATTTCACGAAGTCTGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018769.3-1710s21c1
Sequence:CCGGGAGCGTTGTCAATGGGTTATTCTCGAGAATAACCCATTGACAACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018769.3-730s21c1
Sequence:CCGGGAGCTGTTTGTGAAACAAGATCTCGAGATCTTGTTTCACAAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018769.3-306s1c1
Sequence:CCGGGAGCAAGTGTGAGAACCATAACTCGAGTTATGGTTCTCACACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018769.3-458s21c1
Sequence:CCGGCCGTCAAGAGAACAGTTAATACTCGAGTATTAACTGTTCTCTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004403
VALIDATED
DFNA5 MISSION shRNA Bacterial Glycerol Stock
deafness, autosomal dominant 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004403.1-1679s1c1
Sequence:CCGGGCATGATGAATGACCTGACTTCTCGAGAAGTCAGGTCATTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004403.1-847s1c1
Sequence:CCGGGCATTCATAGACATGCCAGATCTCGAGATCTGGCATGTCTATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004403.1-1330s1c1
Sequence:CCGGGATGATGGAGTATCTGATCTTCTCGAGAAGATCAGATACTCCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004403.1-1003s1c1
Sequence:CCGGGCGGTCCTATTTGATGATGAACTCGAGTTCATCATCAAATAGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004403.2-429s21c1
Sequence:CCGGGCTTCTAAGTCTGGTGACAAACTCGAGTTTGTCACCAGACTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004403.2-1123s21c1
Sequence:CCGGGCATTCATAGACATGCCAGATCTCGAGATCTGGCATGTCTATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004403.2-1606s21c1
Sequence:CCGGGATGATGGAGTATCTGATCTTCTCGAGAAGATCAGATACTCCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004403.2-1955s21c1
Sequence:CCGGGCATGATGAATGACCTGACTTCTCGAGAAGTCAGGTCATTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004403
VALIDATED
DFNA5 MISSION shRNA shRNA Plasmid DNA
deafness, autosomal dominant 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004403.1-1679s1c1
Sequence:CCGGGCATGATGAATGACCTGACTTCTCGAGAAGTCAGGTCATTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004403.1-847s1c1
Sequence:CCGGGCATTCATAGACATGCCAGATCTCGAGATCTGGCATGTCTATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004403.1-1330s1c1
Sequence:CCGGGATGATGGAGTATCTGATCTTCTCGAGAAGATCAGATACTCCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004403.1-1003s1c1
Sequence:CCGGGCGGTCCTATTTGATGATGAACTCGAGTTCATCATCAAATAGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004403.2-429s21c1
Sequence:CCGGGCTTCTAAGTCTGGTGACAAACTCGAGTTTGTCACCAGACTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004403.2-1123s21c1
Sequence:CCGGGCATTCATAGACATGCCAGATCTCGAGATCTGGCATGTCTATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004403.2-1606s21c1
Sequence:CCGGGATGATGGAGTATCTGATCTTCTCGAGAAGATCAGATACTCCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004403.2-1955s21c1
Sequence:CCGGGCATGATGAATGACCTGACTTCTCGAGAAGTCAGGTCATTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004403
VALIDATED
DFNA5 MISSION shRNA Lentiviral Transduction Particles
deafness, autosomal dominant 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004403.1-1679s1c1
Sequence:CCGGGCATGATGAATGACCTGACTTCTCGAGAAGTCAGGTCATTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004403.1-847s1c1
Sequence:CCGGGCATTCATAGACATGCCAGATCTCGAGATCTGGCATGTCTATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004403.1-1330s1c1
Sequence:CCGGGATGATGGAGTATCTGATCTTCTCGAGAAGATCAGATACTCCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004403.1-1003s1c1
Sequence:CCGGGCGGTCCTATTTGATGATGAACTCGAGTTCATCATCAAATAGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004403.2-429s21c1
Sequence:CCGGGCTTCTAAGTCTGGTGACAAACTCGAGTTTGTCACCAGACTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004403.2-1123s21c1
Sequence:CCGGGCATTCATAGACATGCCAGATCTCGAGATCTGGCATGTCTATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004403.2-1606s21c1
Sequence:CCGGGATGATGGAGTATCTGATCTTCTCGAGAAGATCAGATACTCCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004403.2-1955s21c1
Sequence:CCGGGCATGATGAATGACCTGACTTCTCGAGAAGTCAGGTCATTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks