EMAIL THIS PAGE TO A FRIEND

DFNB31

deafness, autosomal recessive 31

64 Gene Product Result for
Synonyms: CIP98 PDZD7B USH2D WHRN WI
Gene ID:
Human(25861) Summary: This gene is thought to function in the organization and stabilization of sterocilia elongation and actin cystoskeletal assembly, based on studies of the related mouse gene. Mutations in this gene have been associated with autosomal recessive non-syndromic deafness and Usher Syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Mar 2010]
Rat(313255) deafness, autosomal recessive 31
chicken(429472) deafness, autosomal recessive 31
cow(533033) deafness, autosomal recessive 31
domestic cat(101083121) deafness, autosomal recessive 31
dog(612588) deafness, autosomal recessive 31
sheep(101118591) deafness, autosomal recessive 31
Domestic Rabbit(100355083) deafness, autosomal recessive 31
naked mole-rat(101723114) deafness, autosomal recessive 31
domestic guinea pig(100726071) deafness, autosomal recessive 31
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015404 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074811 MISSION® esiRNA esiRNA human DFNB31 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083885 Rosetta Predictions human pricing
NM_015404 Rosetta Predictions human pricing
NM_181088 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317201 predicted 2008
2 SASI_Hs02_00317202 predicted 816
3 SASI_Hs02_00317203 predicted 665
4 SASI_Hs02_00317204 predicted 2135
5 SASI_Hs02_00317205 predicted 2177
6 SASI_Hs02_00317206 predicted 1343
7 SASI_Hs02_00317207 predicted 1168
8 SASI_Hs02_00317208 predicted 665
9 SASI_Hs02_00317209 predicted 2165
10 SASI_Hs02_00317210 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193667 predicted 3168
2 SASI_Hs01_00193668 predicted 1969
3 SASI_Hs02_00347770 predicted 1817
4 SASI_Hs02_00347771 predicted 1635
5 SASI_Hs01_00193669 predicted 3289
6 SASI_Hs01_00193670 predicted 3333
7 SASI_Hs01_00193672 predicted 2503
8 SASI_Hs01_00193674 predicted 2328
9 SASI_Hs01_00193675 predicted 1539
10 SASI_Hs01_00193676 predicted 1553
11 SASI_Hs01_00193671 predicted 1114
12 SASI_Hs01_00193673 predicted 2899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109360 predicted 1101
2 SASI_Rn01_00109361 predicted 673
3 SASI_Rn01_00109363 predicted 494
4 SASI_Rn01_00109364 predicted 2223
5 SASI_Rn01_00109365 predicted 2388
6 SASI_Rn01_00109366 predicted 973
7 SASI_Rn01_00109367 predicted 1190
8 SASI_Rn01_00109368 predicted 561
9 SASI_Rn02_00269670 predicted 1669
10 SASI_Rn02_00269671 predicted 1043
11 SASI_Rn01_00109362 predicted 1644
12 SASI_Rn01_00109369 predicted 1412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015404
DFNB31 MISSION shRNA Bacterial Glycerol Stock
deafness, autosomal recessive 31
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015404.1-3773s1c1
Sequence:CCGGGCAAGACCTTTAGTGCCACAACTCGAGTTGTGGCACTAAAGGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015404.1-1618s1c1
Sequence:CCGGCGGAGCTTTCTCAACATCCTACTCGAGTAGGATGTTGAGAAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015404.1-3141s1c1
Sequence:CCGGCCTGCCTAGGATTGTCACTATCTCGAGATAGTGACAATCCTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015404.1-3298s1c1
Sequence:CCGGGACCGTGACTACATTGACTTTCTCGAGAAAGTCAATGTAGTCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015404.1-3300s1c1
Sequence:CCGGCCGTGACTACATTGACTTTCTCTCGAGAGAAAGTCAATGTAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015404
DFNB31 MISSION shRNA shRNA Plasmid DNA
deafness, autosomal recessive 31
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015404.1-3773s1c1
Sequence:CCGGGCAAGACCTTTAGTGCCACAACTCGAGTTGTGGCACTAAAGGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015404.1-1618s1c1
Sequence:CCGGCGGAGCTTTCTCAACATCCTACTCGAGTAGGATGTTGAGAAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015404.1-3141s1c1
Sequence:CCGGCCTGCCTAGGATTGTCACTATCTCGAGATAGTGACAATCCTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015404.1-3298s1c1
Sequence:CCGGGACCGTGACTACATTGACTTTCTCGAGAAAGTCAATGTAGTCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015404.1-3300s1c1
Sequence:CCGGCCGTGACTACATTGACTTTCTCTCGAGAGAAAGTCAATGTAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015404
DFNB31 MISSION shRNA Lentiviral Transduction Particles
deafness, autosomal recessive 31
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015404.1-3773s1c1
Sequence:CCGGGCAAGACCTTTAGTGCCACAACTCGAGTTGTGGCACTAAAGGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015404.1-1618s1c1
Sequence:CCGGCGGAGCTTTCTCAACATCCTACTCGAGTAGGATGTTGAGAAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015404.1-3141s1c1
Sequence:CCGGCCTGCCTAGGATTGTCACTATCTCGAGATAGTGACAATCCTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015404.1-3298s1c1
Sequence:CCGGGACCGTGACTACATTGACTTTCTCGAGAAAGTCAATGTAGTCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015404.1-3300s1c1
Sequence:CCGGCCGTGACTACATTGACTTTCTCTCGAGAGAAAGTCAATGTAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks