EMAIL THIS PAGE TO A FRIEND

DFNB59

deafness, autosomal recessive 59

Synonyms: PJVK
UniProtKB ID: Q0ZLH3, A0PK14, B9EJE2
Gene ID:
Human(494513) Summary: The protein encoded by this gene is a member of the gasdermin family, a family which is found only in vertebrates. The encoded protein is required for the proper function of auditory pathway neurons. Defects in this gene are a cause of non-syndromic sensorineural deafness autosomal recessive type 59 (DFNB59). [provided by RefSeq, Dec 2008]
Mouse(381375) deafness, autosomal recessive 59 (human)
Rat(679552) deafness, autosomal recessive 59
Zebrafish(100006646) deafness, autosomal recessive 59
domestic cat(101094868) deafness, autosomal recessive 59
cow(618114) deafness, autosomal recessive 59
Horse(100053789) deafness, autosomal recessive 59
dog(478817) deafness, autosomal recessive 59
chicken(429015) deafness, autosomal recessive 59
domestic guinea pig(100725790) deafness, autosomal recessive 59
naked mole-rat(101703475) deafness, autosomal recessive 59
sheep(101102040) deafness, autosomal recessive 59
Domestic Rabbit(100355041) deafness, autosomal recessive 59
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001042702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042702 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042702 Rosetta Predictions human pricing
XM_001053449 Rosetta Predictions rat pricing
NM_001080711 Rosetta Predictions mouse pricing
XM_001003976 Rosetta Predictions mouse pricing
XM_355340 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311035 predicted 366
2 SASI_Hs02_00311036 predicted 370
3 SASI_Hs02_00311037 predicted 579
4 SASI_Hs02_00311038 predicted 735
5 SASI_Hs02_00311039 predicted 924
6 SASI_Hs02_00311040 predicted 242
7 SASI_Hs02_00311041 predicted 351
8 SASI_Hs02_00311042 predicted 564
9 SASI_Hs02_00311043 predicted 333
10 SASI_Hs02_00311044 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053449 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272370 predicted 767
2 SASI_Rn02_00272371 predicted 853
3 SASI_Rn02_00272372 predicted 766
4 SASI_Rn02_00272373 predicted 851
5 SASI_Rn02_00272374 predicted 845
6 SASI_Rn02_00272375 predicted 764
7 SASI_Rn02_00272376 predicted 765
8 SASI_Rn02_00272377 predicted 876
9 SASI_Rn02_00272378 predicted 896
10 SASI_Rn02_00272379 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293573 predicted 363
2 SASI_Mm02_00293574 predicted 467
3 SASI_Mm02_00293575 predicted 497
4 SASI_Mm02_00293576 predicted 756
5 SASI_Mm02_00293577 predicted 570
6 SASI_Mm02_00293578 predicted 380
7 SASI_Mm02_00293579 predicted 415
8 SASI_Mm02_00293580 predicted 349
9 SASI_Mm02_00293581 predicted 903
10 SASI_Mm02_00293582 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259275 predicted 902
2 SASI_Mm01_00259276 predicted 1005
3 SASI_Mm01_00259277 predicted 995
4 SASI_Mm01_00259278 predicted 924
5 SASI_Mm01_00259279 predicted 902
6 SASI_Mm01_00259280 predicted 938
7 SASI_Mm01_00259281 predicted 949
8 SASI_Mm01_00259282 predicted 900
9 SASI_Mm01_00259283 predicted 942
10 SASI_Mm01_00259284 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224078 predicted 372
2 SASI_Mm01_00224079 predicted 465
3 SASI_Mm01_00224080 predicted 503
4 SASI_Mm01_00224081 predicted 363
5 SASI_Mm01_00224082 predicted 349
6 SASI_Mm01_00224083 predicted 423
7 SASI_Mm01_00224084 predicted 356
8 SASI_Mm01_00224085 predicted 379
9 SASI_Mm01_00224086 predicted 524
10 SASI_Mm01_00224087 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080711
DFNB59 MISSION shRNA Bacterial Glycerol Stock
deafness, autosomal recessive 59
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-418s21c1
Sequence:CCGGGAAGGCGAAGCAACCATATTGCTCGAGCAATATGGTTGCTTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-332s21c1
Sequence:CCGGTCTCCTGGGAGATCGAGAAATCTCGAGATTTCTCGATCTCCCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-802s21c1
Sequence:CCGGTGGACGGTGCCTTCGACATTTCTCGAGAAATGTCGAAGGCACCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-516s21c1
Sequence:CCGGGAGGTGGAAGTTTCGACATTACTCGAGTAATGTCGAAACTTCCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-477s21c1
Sequence:CCGGATCGCAGTCAAAGCTTCATTTCTCGAGAAATGAAGCTTTGACTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080711
DFNB59 MISSION shRNA shRNA Plasmid DNA
deafness, autosomal recessive 59
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-418s21c1
Sequence:CCGGGAAGGCGAAGCAACCATATTGCTCGAGCAATATGGTTGCTTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-332s21c1
Sequence:CCGGTCTCCTGGGAGATCGAGAAATCTCGAGATTTCTCGATCTCCCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-802s21c1
Sequence:CCGGTGGACGGTGCCTTCGACATTTCTCGAGAAATGTCGAAGGCACCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-516s21c1
Sequence:CCGGGAGGTGGAAGTTTCGACATTACTCGAGTAATGTCGAAACTTCCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-477s21c1
Sequence:CCGGATCGCAGTCAAAGCTTCATTTCTCGAGAAATGAAGCTTTGACTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080711
DFNB59 MISSION shRNA Lentiviral Transduction Particles
deafness, autosomal recessive 59
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-418s21c1
Sequence:CCGGGAAGGCGAAGCAACCATATTGCTCGAGCAATATGGTTGCTTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-332s21c1
Sequence:CCGGTCTCCTGGGAGATCGAGAAATCTCGAGATTTCTCGATCTCCCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-802s21c1
Sequence:CCGGTGGACGGTGCCTTCGACATTTCTCGAGAAATGTCGAAGGCACCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-516s21c1
Sequence:CCGGGAGGTGGAAGTTTCGACATTACTCGAGTAATGTCGAAACTTCCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080711.1-477s21c1
Sequence:CCGGATCGCAGTCAAAGCTTCATTTCTCGAGAAATGAAGCTTTGACTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042702
DFNB59 MISSION shRNA Bacterial Glycerol Stock
deafness, autosomal recessive 59
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-1198s21c1
Sequence:CCGGCTCTCAGCATGACTGATATTTCTCGAGAAATATCAGTCATGCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-1096s21c1
Sequence:CCGGGGTTGAGAAATATCCTATTTGCTCGAGCAAATAGGATATTTCTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-1229s21c1
Sequence:CCGGAGGGACCCATATCCGAGTTAACTCGAGTTAACTCGGATATGGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-625s21c1
Sequence:CCGGGAAGGCGAGGTAACCATATTGCTCGAGCAATATGGTTACCTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-723s21c1
Sequence:CCGGGAAGTGGAAGTATCAACATTACTCGAGTAATGTTGATACTTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042702
DFNB59 MISSION shRNA shRNA Plasmid DNA
deafness, autosomal recessive 59
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-1198s21c1
Sequence:CCGGCTCTCAGCATGACTGATATTTCTCGAGAAATATCAGTCATGCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-1096s21c1
Sequence:CCGGGGTTGAGAAATATCCTATTTGCTCGAGCAAATAGGATATTTCTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-1229s21c1
Sequence:CCGGAGGGACCCATATCCGAGTTAACTCGAGTTAACTCGGATATGGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-625s21c1
Sequence:CCGGGAAGGCGAGGTAACCATATTGCTCGAGCAATATGGTTACCTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-723s21c1
Sequence:CCGGGAAGTGGAAGTATCAACATTACTCGAGTAATGTTGATACTTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042702
DFNB59 MISSION shRNA Lentiviral Transduction Particles
deafness, autosomal recessive 59
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-1198s21c1
Sequence:CCGGCTCTCAGCATGACTGATATTTCTCGAGAAATATCAGTCATGCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-1096s21c1
Sequence:CCGGGGTTGAGAAATATCCTATTTGCTCGAGCAAATAGGATATTTCTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-1229s21c1
Sequence:CCGGAGGGACCCATATCCGAGTTAACTCGAGTTAACTCGGATATGGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-625s21c1
Sequence:CCGGGAAGGCGAGGTAACCATATTGCTCGAGCAATATGGTTACCTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042702.3-723s21c1
Sequence:CCGGGAAGTGGAAGTATCAACATTACTCGAGTAATGTTGATACTTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks