EMAIL THIS PAGE TO A FRIEND

DGAT1

diacylglycerol O-acyltransferase 1

56 Gene Product Result for
Synonyms: ARAT ARGP1 DGAT
UniProtKB ID: O75907, B2RWQ2, D3DWL6, Q96BB8
Gene ID:
Human(8694) Summary: This gene encodes an multipass transmembrane protein that functions as a key metabolic enzyme. The encoded protein catalyzes the conversion of diacylglycerol and fatty acyl CoA to triacylglycerol. This enzyme can also transfer acyl CoA to retinol. Activity of this protein may be associated with obesity and other metabolic diseases. [provided by RefSeq, Jul 2013]
Mouse(13350) diacylglycerol O-acyltransferase 1
Rat(84497) diacylglycerol O-acyltransferase 1
domestic cat(101101615) diacylglycerol O-acyltransferase 1
cow(282609) diacylglycerol O-acyltransferase 1
dog(482093) diacylglycerol O-acyltransferase 1
Goat(100861225) diacylglycerol O-acyltransferase 1
sheep(100126245) diacylglycerol O-acyltransferase 1
naked mole-rat(101723650) diacylglycerol O-acyltransferase 1
domestic guinea pig(100733854) diacylglycerol O-acyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500307 Anti-DGAT1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, canine, human
ELISA, immunohistochemistry, western blot pricing
SAB4301075 Anti-DGAT1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012079 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012079 Rosetta Predictions human pricing
NM_053437 Rosetta Predictions rat pricing
XM_579557 Rosetta Predictions rat pricing
NM_010046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077408 predicted 1190
2 SASI_Hs01_00077409 predicted 1586
3 SASI_Hs01_00077410 predicted 804
4 SASI_Hs01_00077411 predicted 1375
5 SASI_Hs01_00077414 predicted 1202
6 SASI_Hs01_00077415 predicted 1660
7 SASI_Hs01_00077416 predicted 1088
8 SASI_Hs01_00077417 predicted 1362
9 SASI_Hs02_00343558 predicted 668
10 SASI_Hs02_00343559 predicted 556
11 SASI_Hs01_00077412 predicted 1458
12 SASI_Hs01_00077413 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078203 predicted 1011
2 SASI_Rn01_00078204 predicted 350
3 SASI_Rn01_00078205 predicted 463
4 SASI_Rn01_00078206 predicted 346
5 SASI_Rn01_00078207 predicted 603
6 SASI_Rn02_00266010 predicted 458
7 SASI_Rn01_00078208 predicted 984
8 SASI_Rn02_00266011 predicted 656
9 SASI_Rn01_00078210 predicted 569
10 SASI_Rn01_00078211 predicted 1010
11 SASI_Rn01_00078209 predicted 508
12 SASI_Rn01_00078212 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131256 predicted 1012
2 SASI_Rn01_00131257 predicted 1008
3 SASI_Rn01_00131258 predicted 917
4 SASI_Rn01_00131259 predicted 1006
5 SASI_Rn01_00131260 predicted 963
6 SASI_Rn01_00131261 predicted 1012
7 SASI_Rn01_00131262 predicted 970
8 SASI_Rn01_00131263 predicted 1008
9 SASI_Rn01_00131264 predicted 1012
10 SASI_Rn01_00131265 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165594 predicted 660
2 SASI_Mm01_00165595 predicted 1147
3 SASI_Mm01_00165597 predicted 1019
4 SASI_Mm01_00165598 predicted 347
5 SASI_Mm01_00165599 predicted 1008
6 SASI_Mm01_00165600 predicted 463
7 SASI_Mm01_00165601 predicted 407
8 SASI_Mm01_00165602 predicted 306
9 SASI_Mm01_00165603 predicted 649
10 SASI_Mm02_00317688 predicted 1059
11 SASI_Mm01_00165596 predicted 996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010046
VALIDATED
DGAT1 MISSION shRNA Bacterial Glycerol Stock
diacylglycerol O-acyltransferase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010046.2-1022s21c1
Sequence:CCGGCGGATCATTGAGCGTCTCTTACTCGAGTAAGAGACGCTCAATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010046.2-355s21c1
Sequence:CCGGCCTGAGTAATGCAAGGTTATTCTCGAGAATAACCTTGCATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010046.2-1169s21c1
Sequence:CCGGGCTGAGTCTGTCACCTACTTTCTCGAGAAAGTAGGTGACAGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010046.2-997s21c1
Sequence:CCGGGCCCTTCAAGGATATGGACTACTCGAGTAGTCCATATCCTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-355s1c1
Sequence:CCGGCCTGAGTAATGCAAGGTTATTCTCGAGAATAACCTTGCATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-1022s1c1
Sequence:CCGGCGGATCATTGAGCGTCTCTTACTCGAGTAAGAGACGCTCAATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-997s1c1
Sequence:CCGGGCCCTTCAAGGATATGGACTACTCGAGTAGTCCATATCCTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-1169s1c1
Sequence:CCGGGCTGAGTCTGTCACCTACTTTCTCGAGAAAGTAGGTGACAGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-468s1c1
Sequence:CCGGGCGTGATTATTGCATCCAATACTCGAGTATTGGATGCAATAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010046
VALIDATED
DGAT1 MISSION shRNA shRNA Plasmid DNA
diacylglycerol O-acyltransferase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010046.2-1022s21c1
Sequence:CCGGCGGATCATTGAGCGTCTCTTACTCGAGTAAGAGACGCTCAATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010046.2-355s21c1
Sequence:CCGGCCTGAGTAATGCAAGGTTATTCTCGAGAATAACCTTGCATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010046.2-1169s21c1
Sequence:CCGGGCTGAGTCTGTCACCTACTTTCTCGAGAAAGTAGGTGACAGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010046.2-997s21c1
Sequence:CCGGGCCCTTCAAGGATATGGACTACTCGAGTAGTCCATATCCTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-355s1c1
Sequence:CCGGCCTGAGTAATGCAAGGTTATTCTCGAGAATAACCTTGCATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-1022s1c1
Sequence:CCGGCGGATCATTGAGCGTCTCTTACTCGAGTAAGAGACGCTCAATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-997s1c1
Sequence:CCGGGCCCTTCAAGGATATGGACTACTCGAGTAGTCCATATCCTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-1169s1c1
Sequence:CCGGGCTGAGTCTGTCACCTACTTTCTCGAGAAAGTAGGTGACAGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-468s1c1
Sequence:CCGGGCGTGATTATTGCATCCAATACTCGAGTATTGGATGCAATAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010046
VALIDATED
DGAT1 MISSION shRNA Lentiviral Transduction Particles
diacylglycerol O-acyltransferase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010046.2-1022s21c1
Sequence:CCGGCGGATCATTGAGCGTCTCTTACTCGAGTAAGAGACGCTCAATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010046.2-355s21c1
Sequence:CCGGCCTGAGTAATGCAAGGTTATTCTCGAGAATAACCTTGCATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010046.2-1169s21c1
Sequence:CCGGGCTGAGTCTGTCACCTACTTTCTCGAGAAAGTAGGTGACAGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010046.2-997s21c1
Sequence:CCGGGCCCTTCAAGGATATGGACTACTCGAGTAGTCCATATCCTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-355s1c1
Sequence:CCGGCCTGAGTAATGCAAGGTTATTCTCGAGAATAACCTTGCATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-1022s1c1
Sequence:CCGGCGGATCATTGAGCGTCTCTTACTCGAGTAAGAGACGCTCAATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-997s1c1
Sequence:CCGGGCCCTTCAAGGATATGGACTACTCGAGTAGTCCATATCCTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-1169s1c1
Sequence:CCGGGCTGAGTCTGTCACCTACTTTCTCGAGAAAGTAGGTGACAGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010046.2-468s1c1
Sequence:CCGGGCGTGATTATTGCATCCAATACTCGAGTATTGGATGCAATAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012079
VALIDATED
DGAT1 MISSION shRNA Bacterial Glycerol Stock
diacylglycerol O-acyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012079.3-1050s21c1
Sequence:CCGGTGTGCTACGAGCTCAACTTTCCTCGAGGAAAGTTGAGCTCGTAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012079.3-1692s21c1
Sequence:CCGGACTACTACGTGCTCAACTATGCTCGAGCATAGTTGAGCACGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012079.3-560s21c1
Sequence:CCGGTTGAGCAATGCCCGGTTATTTCTCGAGAAATAACCGGGCATTGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012079.3-636s21c1
Sequence:CCGGTGTTCCTGAAGGATCCCTATACTCGAGTATAGGGATCCTTCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012079.3-473s21c1
Sequence:CCGGCATCGCCTGCAGGATTCTTTACTCGAGTAAAGAATCCTGCAGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012079.2-1666s1c1
Sequence:CCGGCGACTACTACGTGCTCAACTACTCGAGTAGTTGAGCACGTAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012079.2-562s1c1
Sequence:CCGGGAACCTCATCAAGTATGGCATCTCGAGATGCCATACTTGATGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012079.2-535s1c1
Sequence:CCGGCTTGAGCAATGCCCGGTTATTCTCGAGAATAACCGGGCATTGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_012079.2-1402s1c1
Sequence:CCGGCAGACACTTCTACAAGCCCATCTCGAGATGGGCTTGTAGAAGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012079.2-1183s1c1
Sequence:CCGGCATGGACTACTCACGCATCATCTCGAGATGATGCGTGAGTAGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012079
VALIDATED
DGAT1 MISSION shRNA shRNA Plasmid DNA
diacylglycerol O-acyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012079.3-1050s21c1
Sequence:CCGGTGTGCTACGAGCTCAACTTTCCTCGAGGAAAGTTGAGCTCGTAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012079.3-1692s21c1
Sequence:CCGGACTACTACGTGCTCAACTATGCTCGAGCATAGTTGAGCACGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012079.3-560s21c1
Sequence:CCGGTTGAGCAATGCCCGGTTATTTCTCGAGAAATAACCGGGCATTGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012079.3-636s21c1
Sequence:CCGGTGTTCCTGAAGGATCCCTATACTCGAGTATAGGGATCCTTCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012079.3-473s21c1
Sequence:CCGGCATCGCCTGCAGGATTCTTTACTCGAGTAAAGAATCCTGCAGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012079.2-1666s1c1
Sequence:CCGGCGACTACTACGTGCTCAACTACTCGAGTAGTTGAGCACGTAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012079.2-562s1c1
Sequence:CCGGGAACCTCATCAAGTATGGCATCTCGAGATGCCATACTTGATGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012079.2-535s1c1
Sequence:CCGGCTTGAGCAATGCCCGGTTATTCTCGAGAATAACCGGGCATTGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_012079.2-1402s1c1
Sequence:CCGGCAGACACTTCTACAAGCCCATCTCGAGATGGGCTTGTAGAAGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012079.2-1183s1c1
Sequence:CCGGCATGGACTACTCACGCATCATCTCGAGATGATGCGTGAGTAGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012079
VALIDATED
DGAT1 MISSION shRNA Lentiviral Transduction Particles
diacylglycerol O-acyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012079.3-1050s21c1
Sequence:CCGGTGTGCTACGAGCTCAACTTTCCTCGAGGAAAGTTGAGCTCGTAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012079.3-1692s21c1
Sequence:CCGGACTACTACGTGCTCAACTATGCTCGAGCATAGTTGAGCACGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012079.3-560s21c1
Sequence:CCGGTTGAGCAATGCCCGGTTATTTCTCGAGAAATAACCGGGCATTGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012079.3-636s21c1
Sequence:CCGGTGTTCCTGAAGGATCCCTATACTCGAGTATAGGGATCCTTCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012079.3-473s21c1
Sequence:CCGGCATCGCCTGCAGGATTCTTTACTCGAGTAAAGAATCCTGCAGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012079.2-1666s1c1
Sequence:CCGGCGACTACTACGTGCTCAACTACTCGAGTAGTTGAGCACGTAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012079.2-562s1c1
Sequence:CCGGGAACCTCATCAAGTATGGCATCTCGAGATGCCATACTTGATGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012079.2-535s1c1
Sequence:CCGGCTTGAGCAATGCCCGGTTATTCTCGAGAATAACCGGGCATTGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_012079.2-1402s1c1
Sequence:CCGGCAGACACTTCTACAAGCCCATCTCGAGATGGGCTTGTAGAAGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012079.2-1183s1c1
Sequence:CCGGCATGGACTACTCACGCATCATCTCGAGATGATGCGTGAGTAGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks