EMAIL THIS PAGE TO A FRIEND

DGAT2

diacylglycerol O-acyltransferase 2

83 Gene Product Result for
Synonyms: ARAT GS1999FULL
Gene ID:
Human(84649) Summary: This gene encodes one of two enzymes which catalyzes the final reaction in the synthesis of triglycerides in which diacylglycerol is covalently bound to long chain fatty acyl-CoAs. The encoded protein catalyzes this reaction at low concentrations of magnesium chloride while the other enzyme has high activity at high concentrations of magnesium chloride. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(67800) diacylglycerol O-acyltransferase 2
Rat(252900) diacylglycerol O-acyltransferase 2
Zebrafish(565316) diacylglycerol O-acyltransferase 2
cow(404129) diacylglycerol O-acyltransferase 2
domestic cat(101100329) diacylglycerol O-acyltransferase 2
dog(485185) diacylglycerol O-acyltransferase 2
chicken(421309) diacylglycerol O-acyltransferase homolog 2 (mouse)
domestic guinea pig(100718670) diacylglycerol O-acyltransferase 2
naked mole-rat(101698712) diacylglycerol O-acyltransferase 2
sheep(101110535) diacylglycerol O-acyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1415 Human DGAT2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032564 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032564 Rosetta Predictions human pricing
NM_001012345 Rosetta Predictions rat pricing
XM_574498 Rosetta Predictions rat pricing
NM_026384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206981 predicted 1044
2 SASI_Hs01_00206982 predicted 892
3 SASI_Hs01_00206983 predicted 1685
4 SASI_Hs01_00206984 predicted 771
5 SASI_Hs01_00206985 predicted 881
6 SASI_Hs01_00206986 predicted 1518
7 SASI_Hs01_00206987 predicted 1599
8 SASI_Hs01_00206988 predicted 1609
9 SASI_Hs02_00360078 predicted 1587
10 SASI_Hs01_00206990 predicted 1506
11 SASI_Hs01_00206989 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090483 predicted 865
2 SASI_Rn01_00090485 predicted 1364
3 SASI_Rn01_00090486 predicted 475
4 SASI_Rn01_00090487 predicted 1072
5 SASI_Rn01_00090488 predicted 1006
6 SASI_Rn01_00090490 predicted 718
7 SASI_Rn01_00090491 predicted 640
8 SASI_Rn01_00090492 predicted 892
9 SASI_Rn02_00200522 predicted 824
10 SASI_Rn02_00200523 predicted 844
11 SASI_Rn01_00090484 predicted 529
12 SASI_Rn01_00090489 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172428 predicted 1317
2 SASI_Rn01_00172429 predicted 970
3 SASI_Rn01_00172430 predicted 1823
4 SASI_Rn01_00172431 predicted 929
5 SASI_Rn01_00172432 predicted 1528
6 SASI_Rn01_00172433 predicted 1459
7 SASI_Rn01_00172434 predicted 1289
8 SASI_Rn01_00172435 predicted 1169
9 SASI_Rn01_00172436 predicted 1086
10 SASI_Rn01_00172437 predicted 1348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105922 predicted 742
2 SASI_Mm01_00105923 predicted 1012
3 SASI_Mm01_00105924 predicted 1098
4 SASI_Mm01_00105925 predicted 964
5 SASI_Mm01_00105926 predicted 1036
6 SASI_Mm02_00330136 predicted 738
7 SASI_Mm01_00105928 predicted 1019
8 SASI_Mm02_00330137 predicted 1034
9 SASI_Mm01_00105929 predicted 1316
10 SASI_Mm01_00105930 predicted 409
11 SASI_Mm01_00105927 predicted 504
12 SASI_Mm01_00105931 predicted 1068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026384
DGAT2 MISSION shRNA Bacterial Glycerol Stock
diacylglycerol O-acyltransferase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026384.2-1508s1c1
Sequence:CCGGCCATTGCAATGTTAGATGTTTCTCGAGAAACATCTAACATTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026384.2-659s1c1
Sequence:CCGGCCAGGAACTATATCTTTGGATCTCGAGATCCAAAGATATAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026384.2-1013s1c1
Sequence:CCGGCTGATCTGGTTCCCACTTATTCTCGAGAATAAGTGGGAACCAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026384.2-744s1c1
Sequence:CCGGCAGCAAGAAGTTTCCTGGCATCTCGAGATGCCAGGAAACTTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026384.2-1035s1c1
Sequence:CCGGCTTTGGAGAGAATGAGGTATACTCGAGTATACCTCATTCTCTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026384.3-1035s21c1
Sequence:CCGGCTTTGGAGAGAATGAGGTATACTCGAGTATACCTCATTCTCTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026384.3-602s21c1
Sequence:CCGGGCTACTTCCGAGACTACTTTCCTCGAGGAAAGTAGTCTCGGAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026384.3-1464s21c1
Sequence:CCGGATGGGTGTCTGTGGGTTATTTCTCGAGAAATAACCCACAGACACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026384.3-756s21c1
Sequence:CCGGTCCTGGCATAAGGCCCTATTTCTCGAGAAATAGGGCCTTATGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026384.3-659s21c1
Sequence:CCGGCCAGGAACTATATCTTTGGATCTCGAGATCCAAAGATATAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026384
DGAT2 MISSION shRNA shRNA Plasmid DNA
diacylglycerol O-acyltransferase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026384.2-1508s1c1
Sequence:CCGGCCATTGCAATGTTAGATGTTTCTCGAGAAACATCTAACATTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026384.2-659s1c1
Sequence:CCGGCCAGGAACTATATCTTTGGATCTCGAGATCCAAAGATATAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026384.2-1013s1c1
Sequence:CCGGCTGATCTGGTTCCCACTTATTCTCGAGAATAAGTGGGAACCAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026384.2-744s1c1
Sequence:CCGGCAGCAAGAAGTTTCCTGGCATCTCGAGATGCCAGGAAACTTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026384.2-1035s1c1
Sequence:CCGGCTTTGGAGAGAATGAGGTATACTCGAGTATACCTCATTCTCTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026384.3-1035s21c1
Sequence:CCGGCTTTGGAGAGAATGAGGTATACTCGAGTATACCTCATTCTCTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026384.3-602s21c1
Sequence:CCGGGCTACTTCCGAGACTACTTTCCTCGAGGAAAGTAGTCTCGGAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026384.3-1464s21c1
Sequence:CCGGATGGGTGTCTGTGGGTTATTTCTCGAGAAATAACCCACAGACACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026384.3-756s21c1
Sequence:CCGGTCCTGGCATAAGGCCCTATTTCTCGAGAAATAGGGCCTTATGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026384.3-659s21c1
Sequence:CCGGCCAGGAACTATATCTTTGGATCTCGAGATCCAAAGATATAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026384
DGAT2 MISSION shRNA Lentiviral Transduction Particles
diacylglycerol O-acyltransferase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026384.2-1508s1c1
Sequence:CCGGCCATTGCAATGTTAGATGTTTCTCGAGAAACATCTAACATTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026384.2-659s1c1
Sequence:CCGGCCAGGAACTATATCTTTGGATCTCGAGATCCAAAGATATAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026384.2-1013s1c1
Sequence:CCGGCTGATCTGGTTCCCACTTATTCTCGAGAATAAGTGGGAACCAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026384.2-744s1c1
Sequence:CCGGCAGCAAGAAGTTTCCTGGCATCTCGAGATGCCAGGAAACTTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026384.2-1035s1c1
Sequence:CCGGCTTTGGAGAGAATGAGGTATACTCGAGTATACCTCATTCTCTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026384.3-1035s21c1
Sequence:CCGGCTTTGGAGAGAATGAGGTATACTCGAGTATACCTCATTCTCTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026384.3-602s21c1
Sequence:CCGGGCTACTTCCGAGACTACTTTCCTCGAGGAAAGTAGTCTCGGAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026384.3-1464s21c1
Sequence:CCGGATGGGTGTCTGTGGGTTATTTCTCGAGAAATAACCCACAGACACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026384.3-756s21c1
Sequence:CCGGTCCTGGCATAAGGCCCTATTTCTCGAGAAATAGGGCCTTATGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026384.3-659s21c1
Sequence:CCGGCCAGGAACTATATCTTTGGATCTCGAGATCCAAAGATATAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032564
DGAT2 MISSION shRNA Bacterial Glycerol Stock
diacylglycerol O-acyltransferase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032564.2-1631s1c1
Sequence:CCGGGCTCAGCTAACCTCTCTTCTTCTCGAGAAGAAGAGAGGTTAGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032564.2-889s1c1
Sequence:CCGGCCATAGACTATTTGCTTTCAACTCGAGTTGAAAGCAAATAGTCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032564.2-680s1c1
Sequence:CCGGGCTGACCACCAGGAACTATATCTCGAGATATAGTTCCTGGTGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032564.2-1298s1c1
Sequence:CCGGCCTGTACCACACCATGTACATCTCGAGATGTACATGGTGTGGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032564.2-881s1c1
Sequence:CCGGCCGGGACACCATAGACTATTTCTCGAGAAATAGTCTATGGTGTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032564.3-1622s21c1
Sequence:CCGGGTTCTAGGTGGTGGCTAAATCCTCGAGGATTTAGCCACCACCTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032564.3-660s21c1
Sequence:CCGGGCTACTTTCGAGACTACTTTCCTCGAGGAAAGTAGTCTCGAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032564
DGAT2 MISSION shRNA shRNA Plasmid DNA
diacylglycerol O-acyltransferase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032564.2-1631s1c1
Sequence:CCGGGCTCAGCTAACCTCTCTTCTTCTCGAGAAGAAGAGAGGTTAGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032564.2-889s1c1
Sequence:CCGGCCATAGACTATTTGCTTTCAACTCGAGTTGAAAGCAAATAGTCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032564.2-680s1c1
Sequence:CCGGGCTGACCACCAGGAACTATATCTCGAGATATAGTTCCTGGTGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032564.2-1298s1c1
Sequence:CCGGCCTGTACCACACCATGTACATCTCGAGATGTACATGGTGTGGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032564.2-881s1c1
Sequence:CCGGCCGGGACACCATAGACTATTTCTCGAGAAATAGTCTATGGTGTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032564.3-1622s21c1
Sequence:CCGGGTTCTAGGTGGTGGCTAAATCCTCGAGGATTTAGCCACCACCTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032564.3-660s21c1
Sequence:CCGGGCTACTTTCGAGACTACTTTCCTCGAGGAAAGTAGTCTCGAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032564
DGAT2 MISSION shRNA Lentiviral Transduction Particles
diacylglycerol O-acyltransferase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032564.2-1631s1c1
Sequence:CCGGGCTCAGCTAACCTCTCTTCTTCTCGAGAAGAAGAGAGGTTAGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032564.2-889s1c1
Sequence:CCGGCCATAGACTATTTGCTTTCAACTCGAGTTGAAAGCAAATAGTCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032564.2-680s1c1
Sequence:CCGGGCTGACCACCAGGAACTATATCTCGAGATATAGTTCCTGGTGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032564.2-1298s1c1
Sequence:CCGGCCTGTACCACACCATGTACATCTCGAGATGTACATGGTGTGGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032564.2-881s1c1
Sequence:CCGGCCGGGACACCATAGACTATTTCTCGAGAAATAGTCTATGGTGTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032564.3-1622s21c1
Sequence:CCGGGTTCTAGGTGGTGGCTAAATCCTCGAGGATTTAGCCACCACCTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032564.3-660s21c1
Sequence:CCGGGCTACTTTCGAGACTACTTTCCTCGAGGAAAGTAGTCTCGAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks