EMAIL THIS PAGE TO A FRIEND

DGAT2L6

diacylglycerol O-acyltransferase 2-like 6

69 Gene Product Result for
Synonyms: DC3
UniProtKB ID: Q6ZPD8, Q6IEE2
Gene ID:
Mouse(668257) diacylglycerol O-acyltransferase 2-like 6
Rat(678749) diacylglycerol O-acyltransferase 2-like 6
sheep(101122168) diacylglycerol O-acyltransferase 2-like 6
naked mole-rat(101701284) diacylglycerol O-acyltransferase 2-like 6
domestic guinea pig(100716733) diacylglycerol O-acyltransferase 2-like 6
dog(607544) diacylglycerol O-acyltransferase 2-like 6
cow(505958) diacylglycerol O-acyltransferase 2-like 6
domestic cat(101100542) diacylglycerol O-acyltransferase 2-like 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198512 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001114084 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001114084 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001114084 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198512 Rosetta Predictions human pricing
NM_001109370 Rosetta Predictions rat pricing
NM_001114084 Rosetta Predictions mouse pricing
XM_001000486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095604 predicted 576
2 SASI_Hs01_00095605 predicted 1172
3 SASI_Hs01_00095606 predicted 258
4 SASI_Hs02_00372082 predicted 758
5 SASI_Hs01_00095607 predicted 976
6 SASI_Hs01_00095608 predicted 354
7 SASI_Hs01_00095609 predicted 965
8 SASI_Hs01_00095610 predicted 307
9 SASI_Hs01_00095611 predicted 308
10 SASI_Hs01_00095612 predicted 203
11 SASI_Hs01_00095613 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247756 predicted 560
2 SASI_Rn02_00247757 predicted 534
3 SASI_Rn02_00247758 predicted 854
4 SASI_Rn02_00247759 predicted 1041
5 SASI_Rn02_00247760 predicted 256
6 SASI_Rn02_00247761 predicted 517
7 SASI_Rn02_00247762 predicted 374
8 SASI_Rn02_00247763 predicted 1002
9 SASI_Rn02_00247764 predicted 201
10 SASI_Rn02_00247765 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308319 predicted 271
2 SASI_Mm02_00308320 predicted 555
3 SASI_Mm02_00308321 predicted 251
4 SASI_Mm02_00308322 predicted 315
5 SASI_Mm02_00308323 predicted 539
6 SASI_Mm02_00308324 predicted 758
7 SASI_Mm02_00308325 predicted 786
8 SASI_Mm02_00308326 predicted 848
9 SASI_Mm02_00308327 predicted 418
10 SASI_Mm02_00308328 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218105 predicted 218
2 SASI_Mm01_00218106 predicted 213
3 SASI_Mm01_00218107 predicted 210
4 SASI_Mm01_00218108 predicted 403
5 SASI_Mm01_00218109 predicted 370
6 SASI_Mm01_00218110 predicted 564
7 SASI_Mm01_00218111 predicted 581
8 SASI_Mm01_00218112 predicted 707
9 SASI_Mm01_00218113 predicted 704
10 SASI_Mm01_00218114 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198512
DGAT2L6 MISSION shRNA Bacterial Glycerol Stock
diacylglycerol O-acyltransferase 2-like 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198512.1-468s21c1
Sequence:CCGGCCACTGGCATTGCTCGGATTTCTCGAGAAATCCGAGCAATGCCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198512.1-1477s21c1
Sequence:CCGGACCATCACTACGTAGGTTTAGCTCGAGCTAAACCTACGTAGTGATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198512.1-331s21c1
Sequence:CCGGATGGAAGTATTTCCGAAATTACTCGAGTAATTTCGGAAATACTTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131180    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198512.1-1220s1c1
Sequence:CCGGGAGACCATCCAAGCCAGAAATCTCGAGATTTCTGGCTTGGATGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198512.1-1455s1c1
Sequence:CCGGCCTTTCTCCTAAACCTTAGTTCTCGAGAACTAAGGTTTAGGAGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198512.1-547s1c1
Sequence:CCGGGCGAGAATATGTGATGTCAATCTCGAGATTGACATCACATATTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198512.1-395s1c1
Sequence:CCGGCACAACTACATCATTGCCAATCTCGAGATTGGCAATGATGTAGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198512.1-997s1c1
Sequence:CCGGCCAGAAGACAGTAGACAAGTACTCGAGTACTTGTCTACTGTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198512.1-1506s1c1
Sequence:CCGGGCTTTATTTGGAACAGGGATACTCGAGTATCCCTGTTCCAAATAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198512.1-272s1c1
Sequence:CCGGGATTGGAACACCCACAGTCAACTCGAGTTGACTGTGGGTGTTCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198512
DGAT2L6 MISSION shRNA shRNA Plasmid DNA
diacylglycerol O-acyltransferase 2-like 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198512.1-468s21c1
Sequence:CCGGCCACTGGCATTGCTCGGATTTCTCGAGAAATCCGAGCAATGCCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198512.1-1477s21c1
Sequence:CCGGACCATCACTACGTAGGTTTAGCTCGAGCTAAACCTACGTAGTGATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198512.1-331s21c1
Sequence:CCGGATGGAAGTATTTCCGAAATTACTCGAGTAATTTCGGAAATACTTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131180    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198512.1-1220s1c1
Sequence:CCGGGAGACCATCCAAGCCAGAAATCTCGAGATTTCTGGCTTGGATGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198512.1-1455s1c1
Sequence:CCGGCCTTTCTCCTAAACCTTAGTTCTCGAGAACTAAGGTTTAGGAGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198512.1-547s1c1
Sequence:CCGGGCGAGAATATGTGATGTCAATCTCGAGATTGACATCACATATTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198512.1-395s1c1
Sequence:CCGGCACAACTACATCATTGCCAATCTCGAGATTGGCAATGATGTAGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198512.1-997s1c1
Sequence:CCGGCCAGAAGACAGTAGACAAGTACTCGAGTACTTGTCTACTGTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198512.1-1506s1c1
Sequence:CCGGGCTTTATTTGGAACAGGGATACTCGAGTATCCCTGTTCCAAATAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198512.1-272s1c1
Sequence:CCGGGATTGGAACACCCACAGTCAACTCGAGTTGACTGTGGGTGTTCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198512
DGAT2L6 MISSION shRNA Lentiviral Transduction Particles
diacylglycerol O-acyltransferase 2-like 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198512.1-468s21c1
Sequence:CCGGCCACTGGCATTGCTCGGATTTCTCGAGAAATCCGAGCAATGCCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198512.1-1477s21c1
Sequence:CCGGACCATCACTACGTAGGTTTAGCTCGAGCTAAACCTACGTAGTGATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198512.1-331s21c1
Sequence:CCGGATGGAAGTATTTCCGAAATTACTCGAGTAATTTCGGAAATACTTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131180    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198512.1-1220s1c1
Sequence:CCGGGAGACCATCCAAGCCAGAAATCTCGAGATTTCTGGCTTGGATGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198512.1-1455s1c1
Sequence:CCGGCCTTTCTCCTAAACCTTAGTTCTCGAGAACTAAGGTTTAGGAGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198512.1-547s1c1
Sequence:CCGGGCGAGAATATGTGATGTCAATCTCGAGATTGACATCACATATTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198512.1-395s1c1
Sequence:CCGGCACAACTACATCATTGCCAATCTCGAGATTGGCAATGATGTAGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198512.1-997s1c1
Sequence:CCGGCCAGAAGACAGTAGACAAGTACTCGAGTACTTGTCTACTGTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198512.1-1506s1c1
Sequence:CCGGGCTTTATTTGGAACAGGGATACTCGAGTATCCCTGTTCCAAATAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198512.1-272s1c1
Sequence:CCGGGATTGGAACACCCACAGTCAACTCGAGTTGACTGTGGGTGTTCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114084
DGAT2L6 MISSION shRNA Bacterial Glycerol Stock
diacylglycerol O-acyltransferase 2-like 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114084.1-378s21c1
Sequence:CCGGCCAAACACAACTACATCATTCCTCGAGGAATGATGTAGTTGTGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114084.1-426s21c1
Sequence:CCGGATGGTGCCTTCATCAACTTTGCTCGAGCAAAGTTGATGAAGGCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114084.1-544s21c1
Sequence:CCGGTCTGATGTCCTTGGGTATTTGCTCGAGCAAATACCCAAGGACATCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114084.1-311s21c1
Sequence:CCGGTGGACCCTGTGGAAGTATTTCCTCGAGGAAATACTTCCACAGGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114084.1-1200s21c1
Sequence:CCGGTATACCAACCAAGCCGGAAATCTCGAGATTTCCGGCTTGGTTGGTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114084
DGAT2L6 MISSION shRNA shRNA Plasmid DNA
diacylglycerol O-acyltransferase 2-like 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114084.1-378s21c1
Sequence:CCGGCCAAACACAACTACATCATTCCTCGAGGAATGATGTAGTTGTGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114084.1-426s21c1
Sequence:CCGGATGGTGCCTTCATCAACTTTGCTCGAGCAAAGTTGATGAAGGCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114084.1-544s21c1
Sequence:CCGGTCTGATGTCCTTGGGTATTTGCTCGAGCAAATACCCAAGGACATCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114084.1-311s21c1
Sequence:CCGGTGGACCCTGTGGAAGTATTTCCTCGAGGAAATACTTCCACAGGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114084.1-1200s21c1
Sequence:CCGGTATACCAACCAAGCCGGAAATCTCGAGATTTCCGGCTTGGTTGGTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114084
DGAT2L6 MISSION shRNA Lentiviral Transduction Particles
diacylglycerol O-acyltransferase 2-like 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114084.1-378s21c1
Sequence:CCGGCCAAACACAACTACATCATTCCTCGAGGAATGATGTAGTTGTGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114084.1-426s21c1
Sequence:CCGGATGGTGCCTTCATCAACTTTGCTCGAGCAAAGTTGATGAAGGCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114084.1-544s21c1
Sequence:CCGGTCTGATGTCCTTGGGTATTTGCTCGAGCAAATACCCAAGGACATCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114084.1-311s21c1
Sequence:CCGGTGGACCCTGTGGAAGTATTTCCTCGAGGAAATACTTCCACAGGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114084.1-1200s21c1
Sequence:CCGGTATACCAACCAAGCCGGAAATCTCGAGATTTCCGGCTTGGTTGGTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)