EMAIL THIS PAGE TO A FRIEND

DGCR14

DiGeorge syndrome critical region gene 14

152 Gene Product Result for
Synonyms: DGCR13 DGS-H DGS-I DGSH DGSI ES2 Es2el
UniProtKB ID: Q96DF8, Q49AH7, Q9BTZ4
Gene ID:
Human(8220) Summary: This gene is located within the minimal DGS critical region (MDGCR) thought to contain the gene(s) responsible for a group of developmental disorders. These disorders include DiGeorge syndrome, velocardiofacial syndrome, conotruncal anomaly face syndrome, and some familial or sporadic conotruncal cardiac defects which have been associated with microdeletion of 22q11.2. The encoded protein may be a component of C complex spliceosomes, and the orthologous protein in the mouse localizes to the nucleus. [provided by RefSeq, Jul 2008]
Mouse(27886) DiGeorge syndrome critical region gene 14
Rat(360741) DiGeorge syndrome critical region gene 14
Zebrafish(324123) DiGeorge syndrome critical region gene 14
cow(513758) DiGeorge syndrome critical region gene 14
domestic cat(101098899) DiGeorge syndrome critical region gene 14
dog(486425) DiGeorge syndrome critical region gene 14
chicken(416925) DiGeorge syndrome critical region gene 14
domestic guinea pig(100726703) DiGeorge syndrome critical region gene 14
naked mole-rat(101724225) DiGeorge syndrome critical region gene 14
sheep(101120112) DiGeorge syndrome critical region gene 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022719 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU000771 MISSION® esiRNA esiRNA targeting mouse Dgcr14 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022719 Rosetta Predictions human pricing
NM_001012472 Rosetta Predictions rat pricing
NM_001081633 Rosetta Predictions mouse pricing
NM_022408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246741 predicted 1439
2 SASI_Hs02_00355942 predicted 1913
3 SASI_Hs01_00246743 predicted 1108
4 SASI_Hs01_00246744 predicted 1165
5 SASI_Hs01_00246745 predicted 1441
6 SASI_Hs01_00246746 predicted 1152
7 SASI_Hs01_00246748 predicted 924
8 SASI_Hs01_00246749 predicted 1022
9 SASI_Hs01_00246750 predicted 1438
10 SASI_Hs02_00355943 predicted 1963
11 SASI_Hs01_00246742 predicted 818
12 SASI_Hs01_00246747 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063480 predicted 1076
2 SASI_Rn01_00063481 predicted 895
3 SASI_Rn01_00063483 predicted 1416
4 SASI_Rn01_00063484 predicted 647
5 SASI_Rn01_00063485 predicted 1156
6 SASI_Rn01_00063486 predicted 671
7 SASI_Rn01_00063488 predicted 1086
8 SASI_Rn02_00200579 predicted 737
9 SASI_Rn02_00200580 predicted 891
10 SASI_Rn02_00200581 predicted 1127
11 SASI_Rn01_00063482 predicted 656
12 SASI_Rn01_00063487 predicted 823
13 SASI_Rn01_00063489 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298720 predicted 1151
2 SASI_Mm02_00298721 predicted 1701
3 SASI_Mm02_00298722 predicted 1186
4 SASI_Mm02_00298723 predicted 769
5 SASI_Mm02_00298724 predicted 769
6 SASI_Mm02_00298725 predicted 1533
7 SASI_Mm02_00298726 predicted 756
8 SASI_Mm02_00298727 predicted 934
9 SASI_Mm02_00298728 predicted 773
10 SASI_Mm02_00298729 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159397 predicted 1159
2 SASI_Mm02_00326578 predicted 1704
3 SASI_Mm01_00159398 predicted 1189
4 SASI_Mm01_00159406 predicted 777
5 SASI_Mm01_00159400 predicted 775
6 SASI_Mm02_00326579 predicted 1537
7 SASI_Mm01_00159401 predicted 751
8 SASI_Mm02_00326580 predicted 945
9 SASI_Mm02_00326581 predicted 778
10 SASI_Mm01_00159402 predicted 1248
11 SASI_Mm01_00159399 predicted 498
12 SASI_Mm01_00159403 predicted 545
13 SASI_Mm01_00159404 predicted 627
14 SASI_Mm01_00159405 predicted 1469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022408
VALIDATED
DGCR14 MISSION shRNA Bacterial Glycerol Stock
DiGeorge syndrome critical region gene 14
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022408.1-1611s1c1
Sequence:CCGGCCACAAATATCTAGTGTTGTTCTCGAGAACAACACTAGATATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022408.1-774s1c1
Sequence:CCGGGCCGAGACAGATAGTACATAACTCGAGTTATGTACTATCTGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022408.1-619s1c1
Sequence:CCGGGAGAAGCGACAGAAAGATAATCTCGAGATTATCTTTCTGTCGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022408.1-172s1c1
Sequence:CCGGGAAGAGTACATCGAGGGACTTCTCGAGAAGTCCCTCGATGTACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022408.1-162s1c1
Sequence:CCGGCCTGGATGAAGAAGAGTACATCTCGAGATGTACTCTTCTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022408.2-1611s21c1
Sequence:CCGGCCACAAATATCTAGTGTTGTTCTCGAGAACAACACTAGATATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022408.2-620s21c1
Sequence:CCGGGAGAAGCGACAGAAAGATAATCTCGAGATTATCTTTCTGTCGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022408.2-163s21c1
Sequence:CCGGCCTGGATGAAGAAGAGTACATCTCGAGATGTACTCTTCTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022408.2-775s21c1
Sequence:CCGGGCCGAGACAGATAGTACATAACTCGAGTTATGTACTATCTGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022408
VALIDATED
DGCR14 MISSION shRNA shRNA Plasmid DNA
DiGeorge syndrome critical region gene 14
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022408.1-1611s1c1
Sequence:CCGGCCACAAATATCTAGTGTTGTTCTCGAGAACAACACTAGATATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022408.1-774s1c1
Sequence:CCGGGCCGAGACAGATAGTACATAACTCGAGTTATGTACTATCTGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022408.1-619s1c1
Sequence:CCGGGAGAAGCGACAGAAAGATAATCTCGAGATTATCTTTCTGTCGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022408.1-172s1c1
Sequence:CCGGGAAGAGTACATCGAGGGACTTCTCGAGAAGTCCCTCGATGTACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022408.1-162s1c1
Sequence:CCGGCCTGGATGAAGAAGAGTACATCTCGAGATGTACTCTTCTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022408.2-1611s21c1
Sequence:CCGGCCACAAATATCTAGTGTTGTTCTCGAGAACAACACTAGATATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022408.2-620s21c1
Sequence:CCGGGAGAAGCGACAGAAAGATAATCTCGAGATTATCTTTCTGTCGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022408.2-163s21c1
Sequence:CCGGCCTGGATGAAGAAGAGTACATCTCGAGATGTACTCTTCTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022408.2-775s21c1
Sequence:CCGGGCCGAGACAGATAGTACATAACTCGAGTTATGTACTATCTGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022408
VALIDATED
DGCR14 MISSION shRNA Lentiviral Transduction Particles
DiGeorge syndrome critical region gene 14
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022408.1-1611s1c1
Sequence:CCGGCCACAAATATCTAGTGTTGTTCTCGAGAACAACACTAGATATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022408.1-774s1c1
Sequence:CCGGGCCGAGACAGATAGTACATAACTCGAGTTATGTACTATCTGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022408.1-619s1c1
Sequence:CCGGGAGAAGCGACAGAAAGATAATCTCGAGATTATCTTTCTGTCGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022408.1-172s1c1
Sequence:CCGGGAAGAGTACATCGAGGGACTTCTCGAGAAGTCCCTCGATGTACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022408.1-162s1c1
Sequence:CCGGCCTGGATGAAGAAGAGTACATCTCGAGATGTACTCTTCTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022408.2-1611s21c1
Sequence:CCGGCCACAAATATCTAGTGTTGTTCTCGAGAACAACACTAGATATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022408.2-620s21c1
Sequence:CCGGGAGAAGCGACAGAAAGATAATCTCGAGATTATCTTTCTGTCGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022408.2-163s21c1
Sequence:CCGGCCTGGATGAAGAAGAGTACATCTCGAGATGTACTCTTCTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022408.2-775s21c1
Sequence:CCGGGCCGAGACAGATAGTACATAACTCGAGTTATGTACTATCTGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022719
VALIDATED
DGCR14 MISSION shRNA Bacterial Glycerol Stock
DiGeorge syndrome critical region gene 14
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022719.1-164s1c1
Sequence:CCGGCAAAGGGATTTCTTTCCTGATCTCGAGATCAGGAAAGAAATCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022719.1-987s1c1
Sequence:CCGGTGAGAGTTGAAGGGTCGGAAACTCGAGTTTCCGACCCTTCAACTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022719.2-498s21c1
Sequence:CCGGGCTACACGAGTGAGGACAATGCTCGAGCATTGTCCTCACTCGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022719.2-1666s21c1
Sequence:CCGGTGCCAAGCTGTTTGCTGTTTACTCGAGTAAACAGCAAACAGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022719.2-610s21c1
Sequence:CCGGGCAGAAAGATAATCTCGAACTCTCGAGAGTTCGAGATTATCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022719.2-256s21c1
Sequence:CCGGGAATGGAGACTTGGAACGGATCTCGAGATCCGTTCCAAGTCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022719
VALIDATED
DGCR14 MISSION shRNA shRNA Plasmid DNA
DiGeorge syndrome critical region gene 14
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022719.1-164s1c1
Sequence:CCGGCAAAGGGATTTCTTTCCTGATCTCGAGATCAGGAAAGAAATCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022719.1-987s1c1
Sequence:CCGGTGAGAGTTGAAGGGTCGGAAACTCGAGTTTCCGACCCTTCAACTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022719.2-498s21c1
Sequence:CCGGGCTACACGAGTGAGGACAATGCTCGAGCATTGTCCTCACTCGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022719.2-1666s21c1
Sequence:CCGGTGCCAAGCTGTTTGCTGTTTACTCGAGTAAACAGCAAACAGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022719.2-610s21c1
Sequence:CCGGGCAGAAAGATAATCTCGAACTCTCGAGAGTTCGAGATTATCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022719.2-256s21c1
Sequence:CCGGGAATGGAGACTTGGAACGGATCTCGAGATCCGTTCCAAGTCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022719
VALIDATED
DGCR14 MISSION shRNA Lentiviral Transduction Particles
DiGeorge syndrome critical region gene 14
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022719.1-164s1c1
Sequence:CCGGCAAAGGGATTTCTTTCCTGATCTCGAGATCAGGAAAGAAATCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022719.1-987s1c1
Sequence:CCGGTGAGAGTTGAAGGGTCGGAAACTCGAGTTTCCGACCCTTCAACTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022719.2-498s21c1
Sequence:CCGGGCTACACGAGTGAGGACAATGCTCGAGCATTGTCCTCACTCGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022719.2-1666s21c1
Sequence:CCGGTGCCAAGCTGTTTGCTGTTTACTCGAGTAAACAGCAAACAGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022719.2-610s21c1
Sequence:CCGGGCAGAAAGATAATCTCGAACTCTCGAGAGTTCGAGATTATCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022719.2-256s21c1
Sequence:CCGGGAATGGAGACTTGGAACGGATCTCGAGATCCGTTCCAAGTCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks