EMAIL THIS PAGE TO A FRIEND

DGCR2

DiGeorge syndrome critical region gene 2

53 Gene Product Result for
Synonyms: DGS-C IDD LAN SEZ-12
UniProtKB ID: P98153, A6NIB5, A8K6K5, B7Z935
Gene ID:
Human(9993) Summary: Deletions of the 22q11.2 have been associated with a wide range of developmental defects (notably DiGeorge syndrome, velocardiofacial syndrome, conotruncal anomaly face syndrome and isolated conotruncal cardiac defects) classified under the acronym CATCH 22. The DGCR2 gene encodes a novel putative adhesion receptor protein, which could play a role in neural crest cells migration, a process which has been proposed to be altered in DiGeorge syndrome. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(13356) DiGeorge syndrome critical region gene 2
Rat(360742) DiGeorge syndrome critical region gene 2
naked mole-rat(101724932) DiGeorge syndrome critical region gene 2
domestic guinea pig(100725965) DiGeorge syndrome critical region gene 2
Zebrafish(436929) DiGeorge syndrome critical region gene 2
cow(767971) DiGeorge syndrome critical region gene 2
domestic cat(101082016) DiGeorge syndrome critical region gene 2
dog(486428) DiGeorge syndrome critical region gene 2
chicken(416926) DiGeorge syndrome critical region gene 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010048 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010048 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010048 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005137 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005031 MISSION® esiRNA esiRNA targeting human DGCR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005137 Rosetta Predictions human pricing
NM_001012146 Rosetta Predictions rat pricing
XM_573327 Rosetta Predictions rat pricing
NM_001109750 Rosetta Predictions mouse pricing
NM_010048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155589 predicted 783
2 SASI_Hs01_00155590 predicted 803
3 SASI_Hs01_00155591 predicted 2164
4 SASI_Hs01_00155592 predicted 1482
5 SASI_Hs01_00155593 predicted 2176
6 SASI_Hs01_00155594 predicted 1262
7 SASI_Hs02_00339065 predicted 2133
8 SASI_Hs01_00155596 predicted 1078
9 SASI_Hs01_00155597 predicted 1022
10 SASI_Hs01_00155598 predicted 2115
11 SASI_Hs01_00155595 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200323 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185886 predicted 1879
2 SASI_Rn01_00185887 predicted 1886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304254 predicted 1541
2 SASI_Mm02_00304255 predicted 1897
3 SASI_Mm02_00304256 predicted 1599
4 SASI_Mm02_00304257 predicted 1939
5 SASI_Mm02_00304258 predicted 1094
6 SASI_Mm02_00304259 predicted 1399
7 SASI_Mm02_00304260 predicted 1218
8 SASI_Mm02_00304261 predicted 926
9 SASI_Mm02_00304262 predicted 364
10 SASI_Mm02_00304263 predicted 1543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069692 predicted 1544
2 SASI_Mm01_00069694 predicted 1901
3 SASI_Mm01_00069695 predicted 1600
4 SASI_Mm01_00069696 predicted 1944
5 SASI_Mm01_00069697 predicted 1101
6 SASI_Mm01_00069698 predicted 1403
7 SASI_Mm01_00069699 predicted 1229
8 SASI_Mm01_00069700 predicted 930
9 SASI_Mm01_00069701 predicted 358
10 SASI_Mm02_00317690 predicted 1554
11 SASI_Mm01_00069693 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010048
VALIDATED
DGCR2 MISSION shRNA Bacterial Glycerol Stock
DiGeorge syndrome critical region gene 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010048.3-817s21c1
Sequence:CCGGGTTGGTTATCAGTATGTCATTCTCGAGAATGACATACTGATAACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010048.3-2885s21c1
Sequence:CCGGCCTTTAGCATTTCTAAGGTTTCTCGAGAAACCTTAGAAATGCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010048.3-1230s21c1
Sequence:CCGGCCCTAAGGAATGCTGCAAATTCTCGAGAATTTGCAGCATTCCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010048.3-482s21c1
Sequence:CCGGCCCGTCCTTATGGGAAGGAAACTCGAGTTTCCTTCCCATAAGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010048.1-2750s1c1
Sequence:CCGGCCTTTAGCATTTCTAAGGTTTCTCGAGAAACCTTAGAAATGCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010048.1-1417s1c1
Sequence:CCGGACCTCCTTATACAGCTTACAACTCGAGTTGTAAGCTGTATAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010048.1-348s1c1
Sequence:CCGGCCCGTCCTTATGGGAAGGAAACTCGAGTTTCCTTCCCATAAGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010048.1-1096s1c1
Sequence:CCGGCCCTAAGGAATGCTGCAAATTCTCGAGAATTTGCAGCATTCCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010048.1-683s1c1
Sequence:CCGGGTTGGTTATCAGTATGTCATTCTCGAGAATGACATACTGATAACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010048
VALIDATED
DGCR2 MISSION shRNA shRNA Plasmid DNA
DiGeorge syndrome critical region gene 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010048.3-817s21c1
Sequence:CCGGGTTGGTTATCAGTATGTCATTCTCGAGAATGACATACTGATAACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010048.3-2885s21c1
Sequence:CCGGCCTTTAGCATTTCTAAGGTTTCTCGAGAAACCTTAGAAATGCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010048.3-1230s21c1
Sequence:CCGGCCCTAAGGAATGCTGCAAATTCTCGAGAATTTGCAGCATTCCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010048.3-482s21c1
Sequence:CCGGCCCGTCCTTATGGGAAGGAAACTCGAGTTTCCTTCCCATAAGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010048.1-2750s1c1
Sequence:CCGGCCTTTAGCATTTCTAAGGTTTCTCGAGAAACCTTAGAAATGCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010048.1-1417s1c1
Sequence:CCGGACCTCCTTATACAGCTTACAACTCGAGTTGTAAGCTGTATAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010048.1-348s1c1
Sequence:CCGGCCCGTCCTTATGGGAAGGAAACTCGAGTTTCCTTCCCATAAGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010048.1-1096s1c1
Sequence:CCGGCCCTAAGGAATGCTGCAAATTCTCGAGAATTTGCAGCATTCCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010048.1-683s1c1
Sequence:CCGGGTTGGTTATCAGTATGTCATTCTCGAGAATGACATACTGATAACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010048
VALIDATED
DGCR2 MISSION shRNA Lentiviral Transduction Particles
DiGeorge syndrome critical region gene 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010048.3-817s21c1
Sequence:CCGGGTTGGTTATCAGTATGTCATTCTCGAGAATGACATACTGATAACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010048.3-2885s21c1
Sequence:CCGGCCTTTAGCATTTCTAAGGTTTCTCGAGAAACCTTAGAAATGCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010048.3-1230s21c1
Sequence:CCGGCCCTAAGGAATGCTGCAAATTCTCGAGAATTTGCAGCATTCCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010048.3-482s21c1
Sequence:CCGGCCCGTCCTTATGGGAAGGAAACTCGAGTTTCCTTCCCATAAGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010048.1-2750s1c1
Sequence:CCGGCCTTTAGCATTTCTAAGGTTTCTCGAGAAACCTTAGAAATGCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010048.1-1417s1c1
Sequence:CCGGACCTCCTTATACAGCTTACAACTCGAGTTGTAAGCTGTATAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010048.1-348s1c1
Sequence:CCGGCCCGTCCTTATGGGAAGGAAACTCGAGTTTCCTTCCCATAAGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010048.1-1096s1c1
Sequence:CCGGCCCTAAGGAATGCTGCAAATTCTCGAGAATTTGCAGCATTCCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010048.1-683s1c1
Sequence:CCGGGTTGGTTATCAGTATGTCATTCTCGAGAATGACATACTGATAACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005137
VALIDATED
DGCR2 MISSION shRNA Bacterial Glycerol Stock
DiGeorge syndrome critical region gene 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005137.2-1538s21c1
Sequence:CCGGACCTCCCTACACGGCATACAACTCGAGTTGTATGCCGTGTAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005137.2-3076s21c1
Sequence:CCGGTAAGCGGGTTCTGTGCGATTTCTCGAGAAATCGCACAGAACCCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005137.2-1615s21c1
Sequence:CCGGACCCGGACAGTGTGTTCTATGCTCGAGCATAGAACACACTGTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005137.2-951s21c1
Sequence:CCGGCAGCTTCAGTGCTTCCATTTCCTCGAGGAAATGGAAGCACTGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005137.2-793s21c1
Sequence:CCGGGCAAGTTGTGGGTTGGCTATCCTCGAGGATAGCCAACCCACAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005137.1-752s1c1
Sequence:CCGGGTATGTTATCACTGGCCGGAACTCGAGTTCCGGCCAGTGATAACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005137.1-1188s1c1
Sequence:CCGGCCAGATGGCAACAGTCTGTTTCTCGAGAAACAGACTGTTGCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005137.1-1334s1c1
Sequence:CCGGTGGAGCAAACTTGCACCACTTCTCGAGAAGTGGTGCAAGTTTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005137.1-954s1c1
Sequence:CCGGTGCTACGAGAAGTCTTCATTTCTCGAGAAATGAAGACTTCTCGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005137
VALIDATED
DGCR2 MISSION shRNA shRNA Plasmid DNA
DiGeorge syndrome critical region gene 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005137.2-1538s21c1
Sequence:CCGGACCTCCCTACACGGCATACAACTCGAGTTGTATGCCGTGTAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005137.2-3076s21c1
Sequence:CCGGTAAGCGGGTTCTGTGCGATTTCTCGAGAAATCGCACAGAACCCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005137.2-1615s21c1
Sequence:CCGGACCCGGACAGTGTGTTCTATGCTCGAGCATAGAACACACTGTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005137.2-951s21c1
Sequence:CCGGCAGCTTCAGTGCTTCCATTTCCTCGAGGAAATGGAAGCACTGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005137.2-793s21c1
Sequence:CCGGGCAAGTTGTGGGTTGGCTATCCTCGAGGATAGCCAACCCACAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005137.1-752s1c1
Sequence:CCGGGTATGTTATCACTGGCCGGAACTCGAGTTCCGGCCAGTGATAACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005137.1-1188s1c1
Sequence:CCGGCCAGATGGCAACAGTCTGTTTCTCGAGAAACAGACTGTTGCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005137.1-1334s1c1
Sequence:CCGGTGGAGCAAACTTGCACCACTTCTCGAGAAGTGGTGCAAGTTTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005137.1-954s1c1
Sequence:CCGGTGCTACGAGAAGTCTTCATTTCTCGAGAAATGAAGACTTCTCGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005137
VALIDATED
DGCR2 MISSION shRNA Lentiviral Transduction Particles
DiGeorge syndrome critical region gene 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005137.2-1538s21c1
Sequence:CCGGACCTCCCTACACGGCATACAACTCGAGTTGTATGCCGTGTAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005137.2-3076s21c1
Sequence:CCGGTAAGCGGGTTCTGTGCGATTTCTCGAGAAATCGCACAGAACCCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005137.2-1615s21c1
Sequence:CCGGACCCGGACAGTGTGTTCTATGCTCGAGCATAGAACACACTGTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005137.2-951s21c1
Sequence:CCGGCAGCTTCAGTGCTTCCATTTCCTCGAGGAAATGGAAGCACTGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005137.2-793s21c1
Sequence:CCGGGCAAGTTGTGGGTTGGCTATCCTCGAGGATAGCCAACCCACAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005137.1-752s1c1
Sequence:CCGGGTATGTTATCACTGGCCGGAACTCGAGTTCCGGCCAGTGATAACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005137.1-1188s1c1
Sequence:CCGGCCAGATGGCAACAGTCTGTTTCTCGAGAAACAGACTGTTGCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005137.1-1334s1c1
Sequence:CCGGTGGAGCAAACTTGCACCACTTCTCGAGAAGTGGTGCAAGTTTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005137.1-954s1c1
Sequence:CCGGTGCTACGAGAAGTCTTCATTTCTCGAGAAATGAAGACTTCTCGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks