EMAIL THIS PAGE TO A FRIEND

DGCR6

DiGeorge syndrome critical region gene 6

84 Gene Product Result for
UniProtKB ID: Q14129, B2RCH5, D3DX15, Q9BY28
Gene ID:
Human(8214) Summary: DiGeorge syndrome, and more widely, the CATCH 22 syndrome, are associated with microdeletions in chromosomal region 22q11.2. The product of this gene shares homology with the Drosophila melanogaster gonadal protein, which participates in gonadal and germ cell development, and with the gamma-1 subunit of human laminin. This gene is a candidate for involvement in DiGeorge syndrome pathology and in schizophrenia. [provided by RefSeq, Nov 2008]
Mouse(13353) DiGeorge syndrome critical region gene 6
Rat(303794) DiGeorge syndrome critical region gene 6
Zebrafish(403055) DiGeorge syndrome critical region gene 6
cow(100126445) DiGeorge syndrome critical region gene 6
domestic cat(101095382) DiGeorge syndrome critical region gene 6
chicken(395907) DGCR6 homolog
domestic guinea pig(100732889) DiGeorge syndrome critical region gene 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005675 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010047 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010047 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010047 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001107080 Rosetta Predictions rat pricing
NM_010047 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225296 predicted 413
2 SASI_Rn02_00225297 predicted 495
3 SASI_Rn02_00225298 predicted 411
4 SASI_Rn02_00225299 predicted 715
5 SASI_Rn02_00225300 predicted 420
6 SASI_Rn02_00225301 predicted 517
7 SASI_Rn02_00225302 predicted 282
8 SASI_Rn02_00225303 predicted 707
9 SASI_Rn02_00225304 predicted 728
10 SASI_Rn02_00225305 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149197 predicted 685
2 SASI_Mm01_00149198 predicted 502
3 SASI_Mm01_00149199 predicted 755
4 SASI_Mm01_00149200 predicted 986
5 SASI_Mm02_00317689 predicted 765
6 SASI_Mm01_00149201 predicted 388
7 SASI_Mm01_00149202 predicted 966
8 SASI_Mm01_00149203 predicted 552
9 SASI_Mm01_00149204 predicted 547
10 SASI_Mm01_00149205 predicted 1013
11 SASI_Mm01_00149206 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005675
VALIDATED
DGCR6 MISSION shRNA Bacterial Glycerol Stock
DiGeorge syndrome critical region gene 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005675.2-886s1c1
Sequence:CCGGCATCTGGGACTTGCTGTCAAACTCGAGTTTGACAGCAAGTCCCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005675.4-320s21c1
Sequence:CCGGCGACGGCACCGTGTTCGAAATCTCGAGATTTCGAACACGGTGCCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005675.4-248s21c1
Sequence:CCGGGAAGGAGTTGCCCAGCTCATTCTCGAGAATGAGCTGGGCAACTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005675.4-962s21c1
Sequence:CCGGACCCTAGGATAGTCTCATAAACTCGAGTTTATGAGACTATCCTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005675.4-479s21c1
Sequence:CCGGCCATAACCTGCCTGTGCTTCACTCGAGTGAAGCACAGGCAGGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005675.4-560s21c1
Sequence:CCGGGATGGACCAGAAGATCGTCCTCTCGAGAGGACGATCTTCTGGTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005675
VALIDATED
DGCR6 MISSION shRNA shRNA Plasmid DNA
DiGeorge syndrome critical region gene 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005675.2-886s1c1
Sequence:CCGGCATCTGGGACTTGCTGTCAAACTCGAGTTTGACAGCAAGTCCCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005675.4-320s21c1
Sequence:CCGGCGACGGCACCGTGTTCGAAATCTCGAGATTTCGAACACGGTGCCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005675.4-248s21c1
Sequence:CCGGGAAGGAGTTGCCCAGCTCATTCTCGAGAATGAGCTGGGCAACTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005675.4-962s21c1
Sequence:CCGGACCCTAGGATAGTCTCATAAACTCGAGTTTATGAGACTATCCTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005675.4-479s21c1
Sequence:CCGGCCATAACCTGCCTGTGCTTCACTCGAGTGAAGCACAGGCAGGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005675.4-560s21c1
Sequence:CCGGGATGGACCAGAAGATCGTCCTCTCGAGAGGACGATCTTCTGGTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005675
VALIDATED
DGCR6 MISSION shRNA Lentiviral Transduction Particles
DiGeorge syndrome critical region gene 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005675.2-886s1c1
Sequence:CCGGCATCTGGGACTTGCTGTCAAACTCGAGTTTGACAGCAAGTCCCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005675.4-320s21c1
Sequence:CCGGCGACGGCACCGTGTTCGAAATCTCGAGATTTCGAACACGGTGCCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005675.4-248s21c1
Sequence:CCGGGAAGGAGTTGCCCAGCTCATTCTCGAGAATGAGCTGGGCAACTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005675.4-962s21c1
Sequence:CCGGACCCTAGGATAGTCTCATAAACTCGAGTTTATGAGACTATCCTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005675.4-479s21c1
Sequence:CCGGCCATAACCTGCCTGTGCTTCACTCGAGTGAAGCACAGGCAGGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005675.4-560s21c1
Sequence:CCGGGATGGACCAGAAGATCGTCCTCTCGAGAGGACGATCTTCTGGTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010047
VALIDATED
DGCR6 MISSION shRNA Bacterial Glycerol Stock
DiGeorge syndrome critical region gene 6
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010047.1-815s1c1
Sequence:CCGGGATGAACCTATTGGAACTCATCTCGAGATGAGTTCCAATAGGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010047.3-1021s21c1
Sequence:CCGGTGCCATCCACTGTTCAGATTTCTCGAGAAATCTGAACAGTGGATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010047.3-452s21c1
Sequence:CCGGCGACGGAACGGTGTTTGAAATCTCGAGATTTCAAACACCGTTCCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010047.3-554s21c1
Sequence:CCGGAGTGCTCAGACAGACTCTAAGCTCGAGCTTAGAGTCTGTCTGAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010047.3-803s21c1
Sequence:CCGGGACGCTGCAGATGAACCTATTCTCGAGAATAGGTTCATCTGCAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010047.3-688s21c1
Sequence:CCGGAGGCTATGGACCGAAAGATTGCTCGAGCAATCTTTCGGTCCATAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010047
VALIDATED
DGCR6 MISSION shRNA shRNA Plasmid DNA
DiGeorge syndrome critical region gene 6
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010047.1-815s1c1
Sequence:CCGGGATGAACCTATTGGAACTCATCTCGAGATGAGTTCCAATAGGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010047.3-1021s21c1
Sequence:CCGGTGCCATCCACTGTTCAGATTTCTCGAGAAATCTGAACAGTGGATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010047.3-452s21c1
Sequence:CCGGCGACGGAACGGTGTTTGAAATCTCGAGATTTCAAACACCGTTCCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010047.3-554s21c1
Sequence:CCGGAGTGCTCAGACAGACTCTAAGCTCGAGCTTAGAGTCTGTCTGAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010047.3-803s21c1
Sequence:CCGGGACGCTGCAGATGAACCTATTCTCGAGAATAGGTTCATCTGCAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010047.3-688s21c1
Sequence:CCGGAGGCTATGGACCGAAAGATTGCTCGAGCAATCTTTCGGTCCATAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010047
VALIDATED
DGCR6 MISSION shRNA Lentiviral Transduction Particles
DiGeorge syndrome critical region gene 6
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010047.1-815s1c1
Sequence:CCGGGATGAACCTATTGGAACTCATCTCGAGATGAGTTCCAATAGGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010047.3-1021s21c1
Sequence:CCGGTGCCATCCACTGTTCAGATTTCTCGAGAAATCTGAACAGTGGATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010047.3-452s21c1
Sequence:CCGGCGACGGAACGGTGTTTGAAATCTCGAGATTTCAAACACCGTTCCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010047.3-554s21c1
Sequence:CCGGAGTGCTCAGACAGACTCTAAGCTCGAGCTTAGAGTCTGTCTGAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010047.3-803s21c1
Sequence:CCGGGACGCTGCAGATGAACCTATTCTCGAGAATAGGTTCATCTGCAGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010047.3-688s21c1
Sequence:CCGGAGGCTATGGACCGAAAGATTGCTCGAGCAATCTTTCGGTCCATAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)