EMAIL THIS PAGE TO A FRIEND

DGCR6L

DiGeorge syndrome critical region gene 6-like

8 Gene Product Result for
Species: Human DGCR6L(85359)
UniProtKB ID: Q9BY27, A8K1N7, D3DX29, Q9BW33
Gene ID:
Human(85359) Summary: This gene, the result of a duplication at this locus, is one of two functional genes encoding nearly identical proteins that have similar expression patterns. The product of this gene is a protein that shares homology with the Drosophila gonadal protein, expressed in gonadal tissues and germ cells, and with the human laminin gamma-1 chain that functions in cell attachment and migration. This gene is located in a region of chromosome 22 implicated in the DiGeorge syndrome, one facet of a broader collection of anomalies referred to as the CATCH 22 syndrome. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302272 ANTI-DGCR6L (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2107592 Anti-DGCR6L antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033257 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033257 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123629 predicted 222
2 SASI_Hs01_00123630 predicted 676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033257
VALIDATED
DGCR6L MISSION shRNA Bacterial Glycerol Stock
DiGeorge syndrome critical region gene 6-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033257.2-772s21c1
Sequence:CCGGAGAAGTCTGGGCAGAGTTCATCTCGAGATGAACTCTGCCCAGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033257.2-869s21c1
Sequence:CCGGTAGCTGCCTGTCACCCTTCATCTCGAGATGAAGGGTGACAGGCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033257.2-266s21c1
Sequence:CCGGGACGGCACCGTGTTCGAAATCCTCGAGGATTTCGAACACGGTGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033257.2-550s1c1
Sequence:CCGGCCAGCAGAGCACACTGGAGAACTCGAGTTCTCCAGTGTGCTCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033257.2-458s1c1
Sequence:CCGGCGAGAACTAGAGGCCGTGGAACTCGAGTTCCACGGCCTCTAGTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033257.2-719s1c1
Sequence:CCGGGCTGCCCAGTGTGACCAGAAACTCGAGTTTCTGGTCACACTGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033257.2-631s1c1
Sequence:CCGGCCTGCTGGAACTCATCCGAAACTCGAGTTTCGGATGAGTTCCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033257.2-446s1c1
Sequence:CCGGGCGGCTCAGCAGCGAGAACTACTCGAGTAGTTCTCGCTGCTGAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033257
VALIDATED
DGCR6L MISSION shRNA shRNA Plasmid DNA
DiGeorge syndrome critical region gene 6-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033257.2-772s21c1
Sequence:CCGGAGAAGTCTGGGCAGAGTTCATCTCGAGATGAACTCTGCCCAGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033257.2-869s21c1
Sequence:CCGGTAGCTGCCTGTCACCCTTCATCTCGAGATGAAGGGTGACAGGCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033257.2-266s21c1
Sequence:CCGGGACGGCACCGTGTTCGAAATCCTCGAGGATTTCGAACACGGTGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033257.2-550s1c1
Sequence:CCGGCCAGCAGAGCACACTGGAGAACTCGAGTTCTCCAGTGTGCTCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033257.2-458s1c1
Sequence:CCGGCGAGAACTAGAGGCCGTGGAACTCGAGTTCCACGGCCTCTAGTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033257.2-719s1c1
Sequence:CCGGGCTGCCCAGTGTGACCAGAAACTCGAGTTTCTGGTCACACTGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033257.2-631s1c1
Sequence:CCGGCCTGCTGGAACTCATCCGAAACTCGAGTTTCGGATGAGTTCCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033257.2-446s1c1
Sequence:CCGGGCGGCTCAGCAGCGAGAACTACTCGAGTAGTTCTCGCTGCTGAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033257
VALIDATED
DGCR6L MISSION shRNA Lentiviral Transduction Particles
DiGeorge syndrome critical region gene 6-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033257.2-772s21c1
Sequence:CCGGAGAAGTCTGGGCAGAGTTCATCTCGAGATGAACTCTGCCCAGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033257.2-869s21c1
Sequence:CCGGTAGCTGCCTGTCACCCTTCATCTCGAGATGAAGGGTGACAGGCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033257.2-266s21c1
Sequence:CCGGGACGGCACCGTGTTCGAAATCCTCGAGGATTTCGAACACGGTGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033257.2-550s1c1
Sequence:CCGGCCAGCAGAGCACACTGGAGAACTCGAGTTCTCCAGTGTGCTCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033257.2-458s1c1
Sequence:CCGGCGAGAACTAGAGGCCGTGGAACTCGAGTTCCACGGCCTCTAGTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033257.2-719s1c1
Sequence:CCGGGCTGCCCAGTGTGACCAGAAACTCGAGTTTCTGGTCACACTGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033257.2-631s1c1
Sequence:CCGGCCTGCTGGAACTCATCCGAAACTCGAGTTTCGGATGAGTTCCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033257.2-446s1c1
Sequence:CCGGGCGGCTCAGCAGCGAGAACTACTCGAGTAGTTCTCGCTGCTGAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks