EMAIL THIS PAGE TO A FRIEND

DGCR8

DGCR8 microprocessor complex subunit

53 Gene Product Result for
Synonyms: C22orf12 DGCRK6 Gy1 pasha
Gene ID:
Human(54487) Summary: This gene encodes a subunit of the microprocessor complex which mediates the biogenesis of microRNAs from the primary microRNA transcript. The encoded protein is a double-stranded RNA binding protein that functions as the non-catalytic subunit of the microprocessor complex. This protein is required for binding the double-stranded RNA substrate and facilitates cleavage of the RNA by the ribonuclease III protein, Drosha. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
Mouse(94223) DiGeorge syndrome critical region gene 8
Rat(287954) DiGeorge syndrome critical region gene 8
Zebrafish(563963) DiGeorge syndrome critical region gene 8
chicken(416785) DiGeorge syndrome critical region gene 8
cow(540254) DiGeorge syndrome critical region gene 8
domestic cat(101096112) DiGeorge syndrome critical region gene 8
dog(486416) DiGeorge syndrome critical region gene 8
domestic guinea pig(100731338) DGCR8 microprocessor complex subunit
naked mole-rat(101725234) DGCR8 microprocessor complex subunit
sheep(101122137) DiGeorge syndrome critical region gene 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022720 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022720 Rosetta Predictions human pricing
NM_001105865 Rosetta Predictions rat pricing
NM_033324 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355944 predicted 2483
2 SASI_Hs01_00096284 predicted 2422
3 SASI_Hs01_00096285 predicted 547
4 SASI_Hs01_00096286 predicted 685
5 SASI_Hs01_00096287 predicted 895
6 SASI_Hs01_00096288 predicted 1615
7 SASI_Hs01_00096289 predicted 1631
8 SASI_Hs01_00096290 predicted 2119
9 SASI_Hs01_00096291 predicted 968
10 SASI_Hs01_00096292 predicted 2351
11 SASI_Hs01_00096293 predicted 1951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213292 predicted 2092
2 SASI_Rn02_00213293 predicted 2135
3 SASI_Rn02_00213294 predicted 828
4 SASI_Rn02_00213295 predicted 1238
5 SASI_Rn02_00213296 predicted 962
6 SASI_Rn02_00213297 predicted 2261
7 SASI_Rn02_00213298 predicted 1961
8 SASI_Rn02_00213299 predicted 2216
9 SASI_Rn02_00213300 predicted 2420
10 SASI_Rn02_00213301 predicted 2514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057338 predicted 1191
2 SASI_Mm02_00337337 predicted 1847
3 SASI_Mm01_00057339 predicted 1070
4 SASI_Mm01_00057340 predicted 541
5 SASI_Mm01_00057341 predicted 957
6 SASI_Mm01_00057342 predicted 1421
7 SASI_Mm01_00057343 predicted 1977
8 SASI_Mm01_00057344 predicted 2141
9 SASI_Mm01_00057345 predicted 2117
10 SASI_Mm02_00337338 predicted 2708
11 SASI_Mm01_00057337 predicted 2245
12 SASI_Mm01_00057346 predicted 1155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022720
DGCR8 MISSION shRNA Bacterial Glycerol Stock
DGCR8 microprocessor complex subunit
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-575s1c1
Sequence:CCGGCCTTCAACTTCTACGGAGCTTCTCGAGAAGCTCCGTAGAAGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-1832s1c1
Sequence:CCGGCCAATCAGAAGCTCATTACTTCTCGAGAAGTAATGAGCTTCTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-972s1c1
Sequence:CCGGGCTCGATGAGTTAGAAGATTTCTCGAGAAATCTTCTAACTCATCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-997s1c1
Sequence:CCGGGACAATTTGGAGCTAGATGAACTCGAGTTCATCTAGCTCCAAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-730s1c1
Sequence:CCGGGTAAAGATTAGCGTGAGCTTTCTCGAGAAAGCTCACGCTAATCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-1871s1c1
Sequence:CCGGCCACAAAGAAAGAGTTTGTTACTCGAGTAACAAACTCTTTCTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-2226s1c1
Sequence:CCGGGCTGTTGTCTCCATATCAGATCTCGAGATCTGATATGGAGACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-2622s1c1
Sequence:CCGGGACTCGAAAGAAGCCCAAGATCTCGAGATCTTGGGCTTCTTTCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-1770s1c1
Sequence:CCGGGCGGCAATTCAATCGGGAAATCTCGAGATTTCCCGATTGAATTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-705s1c1
Sequence:CCGGCCCTGACCTTAAGTTGCTTAACTCGAGTTAAGCAACTTAAGGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-1424s1c1
Sequence:CCGGGCATCCCTTGTCTGCATTATACTCGAGTATAATGCAGACAAGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022720.5-2731s21c1
Sequence:CCGGAGTCATGCATCGTGCACCACACTCGAGTGTGGTGCACGATGCATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-2254s21c1
Sequence:CCGGGTGACACGTCTATCAAGTTTGCTCGAGCAAACTTGATAGACGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-2479s21c1
Sequence:CCGGCATCGGACAAGAGTGTGATTGCTCGAGCAATCACACTCTTGTCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-1357s21c1
Sequence:CCGGGAACGGGAAGCATACGGAAACCTCGAGGTTTCCGTATGCTTCCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-1008s21c1
Sequence:CCGGACGGCTAAAGCAATCGTTCAGCTCGAGCTGAACGATTGCTTTAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-2583s21c1
Sequence:CCGGGAAAGGGAGGAGACTCGAAAGCTCGAGCTTTCGAGTCTCCTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022720
DGCR8 MISSION shRNA shRNA Plasmid DNA
DGCR8 microprocessor complex subunit
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-575s1c1
Sequence:CCGGCCTTCAACTTCTACGGAGCTTCTCGAGAAGCTCCGTAGAAGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-1832s1c1
Sequence:CCGGCCAATCAGAAGCTCATTACTTCTCGAGAAGTAATGAGCTTCTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-972s1c1
Sequence:CCGGGCTCGATGAGTTAGAAGATTTCTCGAGAAATCTTCTAACTCATCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-997s1c1
Sequence:CCGGGACAATTTGGAGCTAGATGAACTCGAGTTCATCTAGCTCCAAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-730s1c1
Sequence:CCGGGTAAAGATTAGCGTGAGCTTTCTCGAGAAAGCTCACGCTAATCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-1871s1c1
Sequence:CCGGCCACAAAGAAAGAGTTTGTTACTCGAGTAACAAACTCTTTCTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-2226s1c1
Sequence:CCGGGCTGTTGTCTCCATATCAGATCTCGAGATCTGATATGGAGACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-2622s1c1
Sequence:CCGGGACTCGAAAGAAGCCCAAGATCTCGAGATCTTGGGCTTCTTTCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-1770s1c1
Sequence:CCGGGCGGCAATTCAATCGGGAAATCTCGAGATTTCCCGATTGAATTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-705s1c1
Sequence:CCGGCCCTGACCTTAAGTTGCTTAACTCGAGTTAAGCAACTTAAGGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-1424s1c1
Sequence:CCGGGCATCCCTTGTCTGCATTATACTCGAGTATAATGCAGACAAGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022720.5-2731s21c1
Sequence:CCGGAGTCATGCATCGTGCACCACACTCGAGTGTGGTGCACGATGCATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-2254s21c1
Sequence:CCGGGTGACACGTCTATCAAGTTTGCTCGAGCAAACTTGATAGACGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-2479s21c1
Sequence:CCGGCATCGGACAAGAGTGTGATTGCTCGAGCAATCACACTCTTGTCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-1357s21c1
Sequence:CCGGGAACGGGAAGCATACGGAAACCTCGAGGTTTCCGTATGCTTCCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-1008s21c1
Sequence:CCGGACGGCTAAAGCAATCGTTCAGCTCGAGCTGAACGATTGCTTTAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-2583s21c1
Sequence:CCGGGAAAGGGAGGAGACTCGAAAGCTCGAGCTTTCGAGTCTCCTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022720
DGCR8 MISSION shRNA Lentiviral Transduction Particles
DGCR8 microprocessor complex subunit
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-575s1c1
Sequence:CCGGCCTTCAACTTCTACGGAGCTTCTCGAGAAGCTCCGTAGAAGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-1832s1c1
Sequence:CCGGCCAATCAGAAGCTCATTACTTCTCGAGAAGTAATGAGCTTCTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-972s1c1
Sequence:CCGGGCTCGATGAGTTAGAAGATTTCTCGAGAAATCTTCTAACTCATCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-997s1c1
Sequence:CCGGGACAATTTGGAGCTAGATGAACTCGAGTTCATCTAGCTCCAAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-730s1c1
Sequence:CCGGGTAAAGATTAGCGTGAGCTTTCTCGAGAAAGCTCACGCTAATCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022720.4-1871s1c1
Sequence:CCGGCCACAAAGAAAGAGTTTGTTACTCGAGTAACAAACTCTTTCTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-2226s1c1
Sequence:CCGGGCTGTTGTCTCCATATCAGATCTCGAGATCTGATATGGAGACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-2622s1c1
Sequence:CCGGGACTCGAAAGAAGCCCAAGATCTCGAGATCTTGGGCTTCTTTCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-1770s1c1
Sequence:CCGGGCGGCAATTCAATCGGGAAATCTCGAGATTTCCCGATTGAATTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-705s1c1
Sequence:CCGGCCCTGACCTTAAGTTGCTTAACTCGAGTTAAGCAACTTAAGGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022720.4-1424s1c1
Sequence:CCGGGCATCCCTTGTCTGCATTATACTCGAGTATAATGCAGACAAGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022720.5-2731s21c1
Sequence:CCGGAGTCATGCATCGTGCACCACACTCGAGTGTGGTGCACGATGCATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-2254s21c1
Sequence:CCGGGTGACACGTCTATCAAGTTTGCTCGAGCAAACTTGATAGACGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-2479s21c1
Sequence:CCGGCATCGGACAAGAGTGTGATTGCTCGAGCAATCACACTCTTGTCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-1357s21c1
Sequence:CCGGGAACGGGAAGCATACGGAAACCTCGAGGTTTCCGTATGCTTCCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-1008s21c1
Sequence:CCGGACGGCTAAAGCAATCGTTCAGCTCGAGCTGAACGATTGCTTTAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022720.5-2583s21c1
Sequence:CCGGGAAAGGGAGGAGACTCGAAAGCTCGAGCTTTCGAGTCTCCTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033324
VALIDATED
DGCR8 MISSION shRNA Bacterial Glycerol Stock
DGCR8 microprocessor complex subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033324.2-2851s1c1
Sequence:CCGGGCTCTCAATGTGACTGGATATCTCGAGATATCCAGTCACATTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033324.2-3270s1c1
Sequence:CCGGGCAGTGAAGATACTGAGTGTTCTCGAGAACACTCAGTATCTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033324.2-1924s1c1
Sequence:CCGGCCGCCCTGTTTATAATTTCTTCTCGAGAAGAAATTATAAACAGGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033324.2-1005s1c1
Sequence:CCGGCGGCTAAAGCAATCGTTCAAACTCGAGTTTGAACGATTGCTTTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033324.2-2875s21c1
Sequence:CCGGTAAGGATCAGTCATAAGTTAACTCGAGTTAACTTATGACTGATCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033324.2-1193s21c1
Sequence:CCGGCCAATGATGACCAAGATTAAACTCGAGTTTAATCTTGGTCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033324.2-1654s21c1
Sequence:CCGGTCTGGAGGAATTTCGTAATTACTCGAGTAATTACGAAATTCCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033324.2-2647s21c1
Sequence:CCGGCTTGTGCACAGTCGATGTATGCTCGAGCATACATCGACTGTGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033324.2-3006s21c1
Sequence:CCGGGAAGTAATACTTCGTTGATAGCTCGAGCTATCAACGAAGTATTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033324.2-1076s21c1
Sequence:CCGGGACAATGATGTGGACGCTTTACTCGAGTAAAGCGTCCACATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033324
VALIDATED
DGCR8 MISSION shRNA shRNA Plasmid DNA
DGCR8 microprocessor complex subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033324.2-2851s1c1
Sequence:CCGGGCTCTCAATGTGACTGGATATCTCGAGATATCCAGTCACATTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033324.2-3270s1c1
Sequence:CCGGGCAGTGAAGATACTGAGTGTTCTCGAGAACACTCAGTATCTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033324.2-1924s1c1
Sequence:CCGGCCGCCCTGTTTATAATTTCTTCTCGAGAAGAAATTATAAACAGGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033324.2-1005s1c1
Sequence:CCGGCGGCTAAAGCAATCGTTCAAACTCGAGTTTGAACGATTGCTTTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033324.2-2875s21c1
Sequence:CCGGTAAGGATCAGTCATAAGTTAACTCGAGTTAACTTATGACTGATCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033324.2-1193s21c1
Sequence:CCGGCCAATGATGACCAAGATTAAACTCGAGTTTAATCTTGGTCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033324.2-1654s21c1
Sequence:CCGGTCTGGAGGAATTTCGTAATTACTCGAGTAATTACGAAATTCCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033324.2-2647s21c1
Sequence:CCGGCTTGTGCACAGTCGATGTATGCTCGAGCATACATCGACTGTGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033324.2-3006s21c1
Sequence:CCGGGAAGTAATACTTCGTTGATAGCTCGAGCTATCAACGAAGTATTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033324.2-1076s21c1
Sequence:CCGGGACAATGATGTGGACGCTTTACTCGAGTAAAGCGTCCACATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033324
VALIDATED
DGCR8 MISSION shRNA Lentiviral Transduction Particles
DGCR8 microprocessor complex subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033324.2-2851s1c1
Sequence:CCGGGCTCTCAATGTGACTGGATATCTCGAGATATCCAGTCACATTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033324.2-3270s1c1
Sequence:CCGGGCAGTGAAGATACTGAGTGTTCTCGAGAACACTCAGTATCTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033324.2-1924s1c1
Sequence:CCGGCCGCCCTGTTTATAATTTCTTCTCGAGAAGAAATTATAAACAGGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033324.2-1005s1c1
Sequence:CCGGCGGCTAAAGCAATCGTTCAAACTCGAGTTTGAACGATTGCTTTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033324.2-2875s21c1
Sequence:CCGGTAAGGATCAGTCATAAGTTAACTCGAGTTAACTTATGACTGATCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033324.2-1193s21c1
Sequence:CCGGCCAATGATGACCAAGATTAAACTCGAGTTTAATCTTGGTCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033324.2-1654s21c1
Sequence:CCGGTCTGGAGGAATTTCGTAATTACTCGAGTAATTACGAAATTCCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033324.2-2647s21c1
Sequence:CCGGCTTGTGCACAGTCGATGTATGCTCGAGCATACATCGACTGTGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033324.2-3006s21c1
Sequence:CCGGGAAGTAATACTTCGTTGATAGCTCGAGCTATCAACGAAGTATTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033324.2-1076s21c1
Sequence:CCGGGACAATGATGTGGACGCTTTACTCGAGTAAAGCGTCCACATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks