EMAIL THIS PAGE TO A FRIEND

DGKA

diacylglycerol kinase, alpha 80kDa

121 Gene Product Result for
Synonyms: DAGK DAGK1 DGK-alpha
Gene ID:
Human(1606) Summary: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(13139) diacylglycerol kinase, alpha
Rat(140866) diacylglycerol kinase, alpha
Zebrafish(564739) diacylglycerol kinase, alpha 80kDa
domestic cat(101092526) diacylglycerol kinase, alpha 80kDa
cow(506348) diacylglycerol kinase, alpha 80kDa
dog(474393) diacylglycerol kinase, alpha 80kDa
sheep(101113224) diacylglycerol kinase, alpha 80kDa
Domestic Rabbit(100347223) diacylglycerol kinase, alpha 80kDa
naked mole-rat(101696575) diacylglycerol kinase, alpha 80kDa
domestic guinea pig(100721358) diacylglycerol kinase, alpha 80kDa
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
D4070 Anti-DGKA (11-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
D4195 Anti-DGKA (351-365) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300980 Anti-DGKA (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300474 Anti-DGKA (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1400069 Anti-DGKA antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
HPA041645 Anti-DGKA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4500615 Anti-DGKA antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
HPA045462 Anti-DGKA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4100396 Monoclonal Anti-DGKA antibody produced in mouse clone DGKA-A339, culture supernatant human
western blot pricing
SAB4100397 Monoclonal Anti-DGKA antibody produced in mouse clone DGKA-B339, culture supernatant human
western blot pricing
SAB1402167 Monoclonal Anti-DGKA antibody produced in mouse clone 2B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001345 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001345 siRNAs that have been validated in the lab human pricing
NM_201444 Rosetta Predictions human pricing
NM_201445 Rosetta Predictions human pricing
NM_201554 Rosetta Predictions human pricing
NM_080787 Rosetta Predictions rat pricing
NM_016811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001345 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072300 validated 2158
2 SASI_Hs01_00072301 predicted 1357
3 SASI_Hs01_00072302 predicted 2241
4 SASI_Hs01_00072303 predicted 761
5 SASI_Hs01_00072304 predicted 1501
6 SASI_Hs01_00072305 predicted 1511
7 SASI_Hs02_00331670 predicted 1441
8 SASI_Hs01_00072306 predicted 1953
9 SASI_Hs01_00072307 predicted 1931
10 SASI_Hs01_00072309 predicted 697
11 SASI_Hs01_00072308 predicted 2385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141318 predicted 2196
2 SASI_Hs01_00141319 predicted 1399
3 SASI_Hs01_00141320 predicted 2283
4 SASI_Hs01_00141321 predicted 805
5 SASI_Hs01_00141322 predicted 1550
6 SASI_Hs01_00141323 predicted 1562
7 SASI_Hs02_00372982 predicted 1484
8 SASI_Hs01_00141324 predicted 1997
9 SASI_Hs01_00141325 predicted 1977
10 SASI_Hs01_00141327 predicted 737
11 SASI_Hs01_00141326 predicted 2436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215687 predicted 2169
2 SASI_Hs01_00215688 predicted 1376
3 SASI_Hs01_00215689 predicted 2253
4 SASI_Hs01_00215690 predicted 765
5 SASI_Hs01_00215691 predicted 1513
6 SASI_Hs01_00215692 predicted 1525
7 SASI_Hs02_00372983 predicted 1452
8 SASI_Hs01_00215693 predicted 1969
9 SASI_Hs01_00215694 predicted 1942
10 SASI_Hs01_00215696 predicted 713
11 SASI_Hs01_00215695 predicted 2403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152299 predicted 2063
2 SASI_Hs01_00152300 predicted 1275
3 SASI_Hs01_00152301 predicted 2149
4 SASI_Hs01_00152302 predicted 674
5 SASI_Hs01_00152303 predicted 1419
6 SASI_Hs01_00152304 predicted 1421
7 SASI_Hs02_00373044 predicted 1351
8 SASI_Hs01_00152305 predicted 1860
9 SASI_Hs01_00152306 predicted 1841
10 SASI_Hs01_00152308 predicted 608
11 SASI_Hs01_00152307 predicted 2297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074616 predicted 1971
2 SASI_Rn02_00267315 predicted 2763
3 SASI_Rn01_00074618 predicted 1269
4 SASI_Rn01_00074619 predicted 2315
5 SASI_Rn01_00074620 predicted 2632
6 SASI_Rn01_00074621 predicted 955
7 SASI_Rn01_00074622 predicted 583
8 SASI_Rn01_00074623 predicted 1499
9 SASI_Rn01_00074624 predicted 1559
10 SASI_Rn01_00074625 predicted 864
11 SASI_Rn01_00074617 predicted 2812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092234 predicted 2294
2 SASI_Mm02_00323606 predicted 1776
3 SASI_Mm01_00092235 predicted 2496
4 SASI_Mm01_00092236 predicted 2096
5 SASI_Mm01_00092238 predicted 931
6 SASI_Mm01_00092239 predicted 1740
7 SASI_Mm01_00092240 predicted 647
8 SASI_Mm01_00092242 predicted 1009
9 SASI_Mm02_00323607 predicted 1163
10 SASI_Mm02_00323608 predicted 1636
11 SASI_Mm01_00092237 predicted 1092
12 SASI_Mm01_00092241 predicted 1454
13 SASI_Mm01_00092243 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016811
DGKA MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, alpha 80kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016811.2-761s21c1
Sequence:CCGGTGATGCGAGTGGCCGAATATCCTCGAGGATATTCGGCCACTCGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016811.2-1587s21c1
Sequence:CCGGTGTTCCTCAGTTCCGGATATTCTCGAGAATATCCGGAACTGAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016811.2-416s21c1
Sequence:CCGGGCGATGTACTGAAGGTCTTTGCTCGAGCAAAGACCTTCAGTACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-772s1c1
Sequence:CCGGGCCGAATATCTAGACTGGGATCTCGAGATCCCAGTCTAGATATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-1032s1c1
Sequence:CCGGCCTGAGCTGTAACTTCTGTAACTCGAGTTACAGAAGTTACAGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-2275s1c1
Sequence:CCGGCGGCTGGAAGTGGTAGGAATACTCGAGTATTCCTACCACTTCCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-1786s1c1
Sequence:CCGGGAGCTAAGTAAGGTGGTATATCTCGAGATATACCACCTTACTTAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-483s1c1
Sequence:CCGGCCTAGGATTTGAACAATTCATCTCGAGATGAATTGTTCAAATCCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016811
DGKA MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, alpha 80kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016811.2-761s21c1
Sequence:CCGGTGATGCGAGTGGCCGAATATCCTCGAGGATATTCGGCCACTCGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016811.2-1587s21c1
Sequence:CCGGTGTTCCTCAGTTCCGGATATTCTCGAGAATATCCGGAACTGAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016811.2-416s21c1
Sequence:CCGGGCGATGTACTGAAGGTCTTTGCTCGAGCAAAGACCTTCAGTACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-772s1c1
Sequence:CCGGGCCGAATATCTAGACTGGGATCTCGAGATCCCAGTCTAGATATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-1032s1c1
Sequence:CCGGCCTGAGCTGTAACTTCTGTAACTCGAGTTACAGAAGTTACAGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-2275s1c1
Sequence:CCGGCGGCTGGAAGTGGTAGGAATACTCGAGTATTCCTACCACTTCCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-1786s1c1
Sequence:CCGGGAGCTAAGTAAGGTGGTATATCTCGAGATATACCACCTTACTTAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-483s1c1
Sequence:CCGGCCTAGGATTTGAACAATTCATCTCGAGATGAATTGTTCAAATCCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016811
DGKA MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, alpha 80kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016811.2-761s21c1
Sequence:CCGGTGATGCGAGTGGCCGAATATCCTCGAGGATATTCGGCCACTCGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016811.2-1587s21c1
Sequence:CCGGTGTTCCTCAGTTCCGGATATTCTCGAGAATATCCGGAACTGAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016811.2-416s21c1
Sequence:CCGGGCGATGTACTGAAGGTCTTTGCTCGAGCAAAGACCTTCAGTACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-772s1c1
Sequence:CCGGGCCGAATATCTAGACTGGGATCTCGAGATCCCAGTCTAGATATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-1032s1c1
Sequence:CCGGCCTGAGCTGTAACTTCTGTAACTCGAGTTACAGAAGTTACAGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-2275s1c1
Sequence:CCGGCGGCTGGAAGTGGTAGGAATACTCGAGTATTCCTACCACTTCCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-1786s1c1
Sequence:CCGGGAGCTAAGTAAGGTGGTATATCTCGAGATATACCACCTTACTTAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016811.2-483s1c1
Sequence:CCGGCCTAGGATTTGAACAATTCATCTCGAGATGAATTGTTCAAATCCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001345
VALIDATED
DGKA MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, alpha 80kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001345.4-1532s1c1
Sequence:CCGGATGTTCCTGATAGCCGGATTTCTCGAGAAATCCGGCTATCAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001345.4-1506s1c1
Sequence:CCGGTGAGATAGGGCTCCGATTATTCTCGAGAATAATCGGAGCCCTATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001345.4-2532s1c1
Sequence:CCGGCTCCCGAGGCTCTGTACATTGCTCGAGCAATGTACAGAGCCTCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001345.4-1734s1c1
Sequence:CCGGGATGAGTAAAGTGGTACATATCTCGAGATATGTACCACTTTACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001345.4-1595s1c1
Sequence:CCGGCCATTGACAAAGCTAACTTGCCTCGAGGCAAGTTAGCTTTGTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_001345.4-592s1c1
Sequence:CCGGCGGCCAGAAGACAAGTTAGAACTCGAGTTCTAACTTGTCTTCTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001345.4-382s1c1
Sequence:CCGGGCTAAATATGTCCAAGGAGATCTCGAGATCTCCTTGGACATATTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001345.4-2262s1c1
Sequence:CCGGCCAAATCTATACCAAGCTCAACTCGAGTTGAGCTTGGTATAGATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001345.4-1443s1c1
Sequence:CCGGGCTCTGGAAGTTCCAGTATATCTCGAGATATACTGGAACTTCCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001345.4-2594s1c1
Sequence:CCGGCCTCACAGTATTTATTATCCTCTCGAGAGGATAATAAATACTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001345
VALIDATED
DGKA MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, alpha 80kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001345.4-1532s1c1
Sequence:CCGGATGTTCCTGATAGCCGGATTTCTCGAGAAATCCGGCTATCAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001345.4-1506s1c1
Sequence:CCGGTGAGATAGGGCTCCGATTATTCTCGAGAATAATCGGAGCCCTATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001345.4-2532s1c1
Sequence:CCGGCTCCCGAGGCTCTGTACATTGCTCGAGCAATGTACAGAGCCTCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001345.4-1734s1c1
Sequence:CCGGGATGAGTAAAGTGGTACATATCTCGAGATATGTACCACTTTACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001345.4-1595s1c1
Sequence:CCGGCCATTGACAAAGCTAACTTGCCTCGAGGCAAGTTAGCTTTGTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_001345.4-592s1c1
Sequence:CCGGCGGCCAGAAGACAAGTTAGAACTCGAGTTCTAACTTGTCTTCTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001345.4-382s1c1
Sequence:CCGGGCTAAATATGTCCAAGGAGATCTCGAGATCTCCTTGGACATATTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001345.4-2262s1c1
Sequence:CCGGCCAAATCTATACCAAGCTCAACTCGAGTTGAGCTTGGTATAGATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001345.4-1443s1c1
Sequence:CCGGGCTCTGGAAGTTCCAGTATATCTCGAGATATACTGGAACTTCCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001345.4-2594s1c1
Sequence:CCGGCCTCACAGTATTTATTATCCTCTCGAGAGGATAATAAATACTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001345
VALIDATED
DGKA MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, alpha 80kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001345.4-1532s1c1
Sequence:CCGGATGTTCCTGATAGCCGGATTTCTCGAGAAATCCGGCTATCAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001345.4-1506s1c1
Sequence:CCGGTGAGATAGGGCTCCGATTATTCTCGAGAATAATCGGAGCCCTATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001345.4-2532s1c1
Sequence:CCGGCTCCCGAGGCTCTGTACATTGCTCGAGCAATGTACAGAGCCTCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001345.4-1734s1c1
Sequence:CCGGGATGAGTAAAGTGGTACATATCTCGAGATATGTACCACTTTACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001345.4-1595s1c1
Sequence:CCGGCCATTGACAAAGCTAACTTGCCTCGAGGCAAGTTAGCTTTGTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_001345.4-592s1c1
Sequence:CCGGCGGCCAGAAGACAAGTTAGAACTCGAGTTCTAACTTGTCTTCTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001345.4-382s1c1
Sequence:CCGGGCTAAATATGTCCAAGGAGATCTCGAGATCTCCTTGGACATATTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001345.4-2262s1c1
Sequence:CCGGCCAAATCTATACCAAGCTCAACTCGAGTTGAGCTTGGTATAGATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001345.4-1443s1c1
Sequence:CCGGGCTCTGGAAGTTCCAGTATATCTCGAGATATACTGGAACTTCCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001345.4-2594s1c1
Sequence:CCGGCCTCACAGTATTTATTATCCTCTCGAGAGGATAATAAATACTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks