EMAIL THIS PAGE TO A FRIEND

DGKB

diacylglycerol kinase, beta 90kDa

156 Gene Product Result for
Synonyms: DAGK2 DGK DGK-BETA
Gene ID:
Human(1607) Summary: Diacylglycerol kinases (DGKs) are regulators of the intracellular concentration of the second messenger diacylglycerol (DAG) and thus play a key role in cellular processes. Nine mammalian isotypes have been identified, which are encoded by separate genes. Mammalian DGK isozymes contain a conserved catalytic (kinase) domain and a cysteine-rich domain (CRD). The protein encoded by this gene is a diacylglycerol kinase, beta isotype. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(217480) diacylglycerol kinase, beta
Rat(54248) diacylglycerol kinase, beta
Zebrafish(557324) diacylglycerol kinase, beta 90kDa
cow(537171) diacylglycerol kinase, beta 90kDa
Horse(100052717) diacylglycerol kinase, beta 90kDa
domestic cat(101082138) diacylglycerol kinase, beta 90kDa
chicken(772367) diacylglycerol kinase, beta 90kDa
dog(482328) diacylglycerol kinase, beta 90kDa
domestic guinea pig(100719783) diacylglycerol kinase, beta 90kDa
naked mole-rat(101713287) diacylglycerol kinase, beta 90kDa
sheep(101102720) diacylglycerol kinase, beta 90kDa
Domestic Rabbit(100355585) diacylglycerol kinase, beta 90kDa
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004080 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004080 Rosetta Predictions human pricing
NM_145695 Rosetta Predictions human pricing
NM_019304 Rosetta Predictions rat pricing
NM_178681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151709 predicted 307
2 SASI_Hs01_00151711 predicted 1020
3 SASI_Hs02_00336878 predicted 604
4 SASI_Hs01_00151712 predicted 879
5 SASI_Hs01_00151713 predicted 921
6 SASI_Hs02_00336879 predicted 1080
7 SASI_Hs01_00151714 predicted 1896
8 SASI_Hs01_00151715 predicted 1239
9 SASI_Hs01_00151716 predicted 358
10 SASI_Hs01_00151717 predicted 1143
11 SASI_Hs01_00151710 predicted 1082
12 SASI_Hs01_00151718 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089129 predicted 307
2 SASI_Hs01_00089131 predicted 1023
3 SASI_Hs02_00365301 predicted 605
4 SASI_Hs01_00089132 predicted 874
5 SASI_Hs01_00089133 predicted 925
6 SASI_Hs02_00365302 predicted 1079
7 SASI_Hs01_00089134 predicted 1900
8 SASI_Hs01_00089135 predicted 1243
9 SASI_Hs01_00089136 predicted 356
10 SASI_Hs01_00089137 predicted 1143
11 SASI_Hs01_00089130 predicted 1082
12 SASI_Hs01_00089138 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055699 predicted 741
2 SASI_Rn01_00055700 predicted 2635
3 SASI_Rn02_00262260 predicted 381
4 SASI_Rn01_00055701 predicted 407
5 SASI_Rn01_00055702 predicted 2792
6 SASI_Rn01_00055703 predicted 434
7 SASI_Rn02_00262261 predicted 1153
8 SASI_Rn01_00055704 predicted 1517
9 SASI_Rn01_00055705 predicted 2694
10 SASI_Rn01_00055708 predicted 946
11 SASI_Rn01_00055706 predicted 2321
12 SASI_Rn01_00055707 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349156 predicted 524
2 SASI_Mm01_00073166 predicted 2828
3 SASI_Mm01_00073167 predicted 855
4 SASI_Mm01_00073168 predicted 703
5 SASI_Mm01_00073169 predicted 2191
6 SASI_Mm01_00073170 predicted 984
7 SASI_Mm01_00073171 predicted 2333
8 SASI_Mm01_00073172 predicted 1660
9 SASI_Mm01_00073173 predicted 964
10 SASI_Mm01_00073174 predicted 1154
11 SASI_Mm01_00073175 predicted 1030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178681
DGKB MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, beta 90kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-885s1c1
Sequence:CCGGCGAGTTTATGTTTCGCCTTTACTCGAGTAAAGGCGAAACATAAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-1297s1c1
Sequence:CCGGCCCTCCTGCATCAAGACATATCTCGAGATATGTCTTGATGCAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-701s1c1
Sequence:CCGGCCCATTCTAGCCCAAATGTAACTCGAGTTACATTTGGGCTAGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-842s1c1
Sequence:CCGGGCTACCTGTCTCTTCTCGAAACTCGAGTTTCGAGAAGAGACAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-1531s1c1
Sequence:CCGGCCTACCACAATCTGTCCAGTTCTCGAGAACTGGACAGATTGTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178681.4-1494s21c1
Sequence:CCGGGACCCTTGAAGGACCATATTTCTCGAGAAATATGGTCCTTCAAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178681.4-1326s21c1
Sequence:CCGGCAGACGTCATGCACCACTATTCTCGAGAATAGTGGTGCATGACGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178681.4-1756s21c1
Sequence:CCGGGAAGCAAGGAGAACGAATTTACTCGAGTAAATTCGTTCTCCTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178681
DGKB MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, beta 90kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-885s1c1
Sequence:CCGGCGAGTTTATGTTTCGCCTTTACTCGAGTAAAGGCGAAACATAAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-1297s1c1
Sequence:CCGGCCCTCCTGCATCAAGACATATCTCGAGATATGTCTTGATGCAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-701s1c1
Sequence:CCGGCCCATTCTAGCCCAAATGTAACTCGAGTTACATTTGGGCTAGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-842s1c1
Sequence:CCGGGCTACCTGTCTCTTCTCGAAACTCGAGTTTCGAGAAGAGACAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-1531s1c1
Sequence:CCGGCCTACCACAATCTGTCCAGTTCTCGAGAACTGGACAGATTGTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178681.4-1494s21c1
Sequence:CCGGGACCCTTGAAGGACCATATTTCTCGAGAAATATGGTCCTTCAAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178681.4-1326s21c1
Sequence:CCGGCAGACGTCATGCACCACTATTCTCGAGAATAGTGGTGCATGACGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178681.4-1756s21c1
Sequence:CCGGGAAGCAAGGAGAACGAATTTACTCGAGTAAATTCGTTCTCCTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178681
DGKB MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, beta 90kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-885s1c1
Sequence:CCGGCGAGTTTATGTTTCGCCTTTACTCGAGTAAAGGCGAAACATAAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-1297s1c1
Sequence:CCGGCCCTCCTGCATCAAGACATATCTCGAGATATGTCTTGATGCAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-701s1c1
Sequence:CCGGCCCATTCTAGCCCAAATGTAACTCGAGTTACATTTGGGCTAGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-842s1c1
Sequence:CCGGGCTACCTGTCTCTTCTCGAAACTCGAGTTTCGAGAAGAGACAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178681.2-1531s1c1
Sequence:CCGGCCTACCACAATCTGTCCAGTTCTCGAGAACTGGACAGATTGTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178681.4-1494s21c1
Sequence:CCGGGACCCTTGAAGGACCATATTTCTCGAGAAATATGGTCCTTCAAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178681.4-1326s21c1
Sequence:CCGGCAGACGTCATGCACCACTATTCTCGAGAATAGTGGTGCATGACGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178681.4-1756s21c1
Sequence:CCGGGAAGCAAGGAGAACGAATTTACTCGAGTAAATTCGTTCTCCTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004080
DGKB MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, beta 90kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004080.x-3870s1c1
Sequence:CCGGCCTGAACTGCATGATTTATTACTCGAGTAATAAATCATGCAGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004080.x-1895s1c1
Sequence:CCGGCCTGCAAGAAGCTACATGAATCTCGAGATTCATGTAGCTTCTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004080.x-2181s1c1
Sequence:CCGGGCAAATATACACAGGCCTGAACTCGAGTTCAGGCCTGTGTATATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004080.x-477s1c1
Sequence:CCGGCCTTTATGACACGGATGGGAACTCGAGTTCCCATCCGTGTCATAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004080.x-1702s1c1
Sequence:CCGGCCTAATGACAAAGATGAGAAACTCGAGTTTCTCATCTTTGTCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004080.1-2039s1c1
Sequence:CCGGGACGAAGCCATCGACGAATAGCTCGAGCTATTCGTCGATGGCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004080.1-2632s1c1
Sequence:CCGGCCTGAAGTGATACTGCATATTCTCGAGAATATGCAGTATCACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004080.1-451s1c1
Sequence:CCGGGAGGATAAGCTTGAGTTTATGCTCGAGCATAAACTCAAGCTTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004080.1-218s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004080
DGKB MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, beta 90kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004080.x-3870s1c1
Sequence:CCGGCCTGAACTGCATGATTTATTACTCGAGTAATAAATCATGCAGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004080.x-1895s1c1
Sequence:CCGGCCTGCAAGAAGCTACATGAATCTCGAGATTCATGTAGCTTCTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004080.x-2181s1c1
Sequence:CCGGGCAAATATACACAGGCCTGAACTCGAGTTCAGGCCTGTGTATATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004080.x-477s1c1
Sequence:CCGGCCTTTATGACACGGATGGGAACTCGAGTTCCCATCCGTGTCATAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004080.x-1702s1c1
Sequence:CCGGCCTAATGACAAAGATGAGAAACTCGAGTTTCTCATCTTTGTCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004080.1-2039s1c1
Sequence:CCGGGACGAAGCCATCGACGAATAGCTCGAGCTATTCGTCGATGGCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004080.1-2632s1c1
Sequence:CCGGCCTGAAGTGATACTGCATATTCTCGAGAATATGCAGTATCACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004080.1-451s1c1
Sequence:CCGGGAGGATAAGCTTGAGTTTATGCTCGAGCATAAACTCAAGCTTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004080.1-218s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004080
DGKB MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, beta 90kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004080.x-3870s1c1
Sequence:CCGGCCTGAACTGCATGATTTATTACTCGAGTAATAAATCATGCAGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004080.x-1895s1c1
Sequence:CCGGCCTGCAAGAAGCTACATGAATCTCGAGATTCATGTAGCTTCTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004080.x-2181s1c1
Sequence:CCGGGCAAATATACACAGGCCTGAACTCGAGTTCAGGCCTGTGTATATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004080.x-477s1c1
Sequence:CCGGCCTTTATGACACGGATGGGAACTCGAGTTCCCATCCGTGTCATAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004080.x-1702s1c1
Sequence:CCGGCCTAATGACAAAGATGAGAAACTCGAGTTTCTCATCTTTGTCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004080.1-2039s1c1
Sequence:CCGGGACGAAGCCATCGACGAATAGCTCGAGCTATTCGTCGATGGCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004080.1-2632s1c1
Sequence:CCGGCCTGAAGTGATACTGCATATTCTCGAGAATATGCAGTATCACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004080.1-451s1c1
Sequence:CCGGGAGGATAAGCTTGAGTTTATGCTCGAGCATAAACTCAAGCTTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004080.1-218s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks