EMAIL THIS PAGE TO A FRIEND

DGKD

diacylglycerol kinase, delta 130kDa

76 Gene Product Result for
Synonyms: DGKdelta dgkd-2
UniProtKB ID: Q16760, Q14158, Q6PK55, Q8NG53
Gene ID:
Human(8527) Summary: This gene encodes a cytoplasmic enzyme that phosphorylates diacylglycerol to produce phosphatidic acid. Diacylglycerol and phosphatidic acid are two lipids that act as second messengers in signaling cascades. Their cellular concentrations are regulated by the encoded protein, and so it is thought to play an important role in cellular signal transduction. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(227333) diacylglycerol kinase, delta
Rat(368088) diacylglycerol kinase, delta
sheep(101112442) diacylglycerol kinase, delta 130kDa
Domestic Rabbit(100345378) diacylglycerol kinase, delta 130kDa
naked mole-rat(101718894) diacylglycerol kinase, delta 130kDa
domestic guinea pig(100731863) diacylglycerol kinase, delta 130kDa
Zebrafish(100536469) diacylglycerol kinase, delta 130kDa
dog(486167) diacylglycerol kinase, delta 130kDa
chicken(424747) diacylglycerol kinase, delta 130kDa
Horse(100065016) diacylglycerol kinase, delta 130kDa
cow(513389) diacylglycerol kinase, delta 130kDa
domestic cat(101085397) diacylglycerol kinase, delta 130kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003648 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_484893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003648 Rosetta Predictions human pricing
NM_152879 Rosetta Predictions human pricing
XM_001065445 Rosetta Predictions rat pricing
XM_347258 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235176 predicted 1743
2 SASI_Hs02_00336016 predicted 2918
3 SASI_Hs01_00235177 predicted 959
4 SASI_Hs01_00235178 predicted 2262
5 SASI_Hs01_00235179 predicted 2155
6 SASI_Hs01_00235180 predicted 389
7 SASI_Hs01_00235181 predicted 1054
8 SASI_Hs01_00235182 predicted 1796
9 SASI_Hs01_00235183 predicted 346
10 SASI_Hs01_00235185 predicted 2191
11 SASI_Hs01_00235184 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083770 predicted 1812
2 SASI_Hs02_00366845 predicted 2982
3 SASI_Hs01_00083771 predicted 1021
4 SASI_Hs01_00083772 predicted 2325
5 SASI_Hs01_00083773 predicted 2211
6 SASI_Hs01_00083774 predicted 453
7 SASI_Hs01_00083775 predicted 1119
8 SASI_Hs01_00083776 predicted 1864
9 SASI_Hs01_00083777 predicted 405
10 SASI_Hs01_00083779 predicted 2261
11 SASI_Hs01_00083778 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065445 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314157 predicted 1118
2 SASI_Rn02_00314158 predicted 2093
3 SASI_Rn02_00314159 predicted 355
4 SASI_Rn02_00314160 predicted 596
5 SASI_Rn02_00314161 predicted 841
6 SASI_Rn02_00314162 predicted 2623
7 SASI_Rn02_00314163 predicted 2257
8 SASI_Rn02_00314164 predicted 2208
9 SASI_Rn02_00314165 predicted 2305
10 SASI_Rn02_00314166 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399616 predicted 353
2 SASI_Rn02_00399617 predicted 1118
3 SASI_Rn02_00399618 predicted 2098
4 SASI_Rn02_00399619 predicted 599
5 SASI_Rn02_00399620 predicted 843
6 SASI_Rn02_00399621 predicted 1662
7 SASI_Rn02_00399622 predicted 2622
8 SASI_Rn02_00399623 predicted 2261
9 SASI_Rn02_00399624 predicted 2210
10 SASI_Rn02_00399625 predicted 2306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003648
VALIDATED
DGKD MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, delta 130kDa
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003648.2-2211s21c1
Sequence:CCGGTAGAGTATTACACGGAGAAATCTCGAGATTTCTCCGTGTAATACTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003648.2-1025s21c1
Sequence:CCGGCACCTCGGCTTACGGTTATTCCTCGAGGAATAACCGTAAGCCGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003648.2-4145s21c1
Sequence:CCGGTCCAGTCTTGTTGATTGTAATCTCGAGATTACAATCAACAAGACTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003648.2-764s21c1
Sequence:CCGGATGGTTCACACATCGTGTAAACTCGAGTTTACACGATGTGTGAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003648.2-909s21c1
Sequence:CCGGCACTGTTGGTCTTCGTCAATTCTCGAGAATTGACGAAGACCAACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003648.2-316s1c1
Sequence:CCGGGCTCATCTTGTGTGCTGATAACTCGAGTTATCAGCACACAAGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003648.2-2201s1c1
Sequence:CCGGCCAGAAACCCTAGAGTATTACCTCGAGGTAATACTCTAGGGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003648.2-2541s1c1
Sequence:CCGGCATCATTCGATGACAAGATTCCTCGAGGAATCTTGTCATCGAATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003648.2-185s1c1
Sequence:CCGGCGAACGCTTTACTATGCCAAACTCGAGTTTGGCATAGTAAAGCGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_003648.x-4146s1c1
Sequence:CCGGCCAGTCTTGTTGATTGTAATTCTCGAGAATTACAATCAACAAGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003648.x-1118s1c1
Sequence:CCGGGACAGCCTCAACCTTCATAAACTCGAGTTTATGAAGGTTGAGGCTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003648.x-350s1c1
Sequence:CCGGGAAGATTGGATTGCAGCATTACTCGAGTAATGCTGCAATCCAATCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003648.x-3299s1c1
Sequence:CCGGCGCCTCGTGACCAAGTTTAAACTCGAGTTTAAACTTGGTCACGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_003648.x-1812s1c1
Sequence:CCGGAGATCATAGAACACACAGAAACTCGAGTTTCTGTGTGTTCTATGATCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003648
VALIDATED
DGKD MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, delta 130kDa
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003648.2-2211s21c1
Sequence:CCGGTAGAGTATTACACGGAGAAATCTCGAGATTTCTCCGTGTAATACTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003648.2-1025s21c1
Sequence:CCGGCACCTCGGCTTACGGTTATTCCTCGAGGAATAACCGTAAGCCGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003648.2-4145s21c1
Sequence:CCGGTCCAGTCTTGTTGATTGTAATCTCGAGATTACAATCAACAAGACTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003648.2-764s21c1
Sequence:CCGGATGGTTCACACATCGTGTAAACTCGAGTTTACACGATGTGTGAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003648.2-909s21c1
Sequence:CCGGCACTGTTGGTCTTCGTCAATTCTCGAGAATTGACGAAGACCAACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003648.2-316s1c1
Sequence:CCGGGCTCATCTTGTGTGCTGATAACTCGAGTTATCAGCACACAAGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003648.2-2201s1c1
Sequence:CCGGCCAGAAACCCTAGAGTATTACCTCGAGGTAATACTCTAGGGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003648.2-2541s1c1
Sequence:CCGGCATCATTCGATGACAAGATTCCTCGAGGAATCTTGTCATCGAATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003648.2-185s1c1
Sequence:CCGGCGAACGCTTTACTATGCCAAACTCGAGTTTGGCATAGTAAAGCGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_003648.x-4146s1c1
Sequence:CCGGCCAGTCTTGTTGATTGTAATTCTCGAGAATTACAATCAACAAGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003648.x-1118s1c1
Sequence:CCGGGACAGCCTCAACCTTCATAAACTCGAGTTTATGAAGGTTGAGGCTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003648.x-350s1c1
Sequence:CCGGGAAGATTGGATTGCAGCATTACTCGAGTAATGCTGCAATCCAATCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003648.x-3299s1c1
Sequence:CCGGCGCCTCGTGACCAAGTTTAAACTCGAGTTTAAACTTGGTCACGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_003648.x-1812s1c1
Sequence:CCGGAGATCATAGAACACACAGAAACTCGAGTTTCTGTGTGTTCTATGATCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003648
VALIDATED
DGKD MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, delta 130kDa
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003648.2-2211s21c1
Sequence:CCGGTAGAGTATTACACGGAGAAATCTCGAGATTTCTCCGTGTAATACTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003648.2-1025s21c1
Sequence:CCGGCACCTCGGCTTACGGTTATTCCTCGAGGAATAACCGTAAGCCGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003648.2-4145s21c1
Sequence:CCGGTCCAGTCTTGTTGATTGTAATCTCGAGATTACAATCAACAAGACTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003648.2-764s21c1
Sequence:CCGGATGGTTCACACATCGTGTAAACTCGAGTTTACACGATGTGTGAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003648.2-909s21c1
Sequence:CCGGCACTGTTGGTCTTCGTCAATTCTCGAGAATTGACGAAGACCAACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003648.2-316s1c1
Sequence:CCGGGCTCATCTTGTGTGCTGATAACTCGAGTTATCAGCACACAAGATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003648.2-2201s1c1
Sequence:CCGGCCAGAAACCCTAGAGTATTACCTCGAGGTAATACTCTAGGGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003648.2-2541s1c1
Sequence:CCGGCATCATTCGATGACAAGATTCCTCGAGGAATCTTGTCATCGAATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_003648.2-185s1c1
Sequence:CCGGCGAACGCTTTACTATGCCAAACTCGAGTTTGGCATAGTAAAGCGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_003648.x-4146s1c1
Sequence:CCGGCCAGTCTTGTTGATTGTAATTCTCGAGAATTACAATCAACAAGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003648.x-1118s1c1
Sequence:CCGGGACAGCCTCAACCTTCATAAACTCGAGTTTATGAAGGTTGAGGCTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003648.x-350s1c1
Sequence:CCGGGAAGATTGGATTGCAGCATTACTCGAGTAATGCTGCAATCCAATCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003648.x-3299s1c1
Sequence:CCGGCGCCTCGTGACCAAGTTTAAACTCGAGTTTAAACTTGGTCACGAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_003648.x-1812s1c1
Sequence:CCGGAGATCATAGAACACACAGAAACTCGAGTTTCTGTGTGTTCTATGATCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484893
DGKD MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, delta 130kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484893.2-5057s1c1
Sequence:CCGGCCTCCCTGAATGGAAATAATTCTCGAGAATTATTTCCATTCAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484893.2-2875s1c1
Sequence:CCGGGCTACCCAGATGGATCAGTTTCTCGAGAAACTGATCCATCTGGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484893.2-174s1c1
Sequence:CCGGGCGAACACTTTACTATGCTAACTCGAGTTAGCATAGTAAAGTGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484893.2-3306s1c1
Sequence:CCGGCCGCCTTGTGACCAAGTTTAACTCGAGTTAAACTTGGTCACAAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484893.2-2205s1c1
Sequence:CCGGCCTAGAATACTACACAGAGAACTCGAGTTCTCTGTGTAGTATTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484893
DGKD MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, delta 130kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484893.2-5057s1c1
Sequence:CCGGCCTCCCTGAATGGAAATAATTCTCGAGAATTATTTCCATTCAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484893.2-2875s1c1
Sequence:CCGGGCTACCCAGATGGATCAGTTTCTCGAGAAACTGATCCATCTGGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484893.2-174s1c1
Sequence:CCGGGCGAACACTTTACTATGCTAACTCGAGTTAGCATAGTAAAGTGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484893.2-3306s1c1
Sequence:CCGGCCGCCTTGTGACCAAGTTTAACTCGAGTTAAACTTGGTCACAAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484893.2-2205s1c1
Sequence:CCGGCCTAGAATACTACACAGAGAACTCGAGTTCTCTGTGTAGTATTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484893
DGKD MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, delta 130kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484893.2-5057s1c1
Sequence:CCGGCCTCCCTGAATGGAAATAATTCTCGAGAATTATTTCCATTCAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484893.2-2875s1c1
Sequence:CCGGGCTACCCAGATGGATCAGTTTCTCGAGAAACTGATCCATCTGGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484893.2-174s1c1
Sequence:CCGGGCGAACACTTTACTATGCTAACTCGAGTTAGCATAGTAAAGTGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484893.2-3306s1c1
Sequence:CCGGCCGCCTTGTGACCAAGTTTAACTCGAGTTAAACTTGGTCACAAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484893.2-2205s1c1
Sequence:CCGGCCTAGAATACTACACAGAGAACTCGAGTTCTCTGTGTAGTATTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)