EMAIL THIS PAGE TO A FRIEND

DGKE

diacylglycerol kinase, epsilon 64kDa

166 Gene Product Result for
Synonyms: DAGK5 DAGK6 DGK NPHS7
UniProtKB ID: P52429, Q9UKQ3
Gene ID:
Human(8526) Summary: Diacylglycerol kinases are thought to be involved mainly in the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. When expressed in mammalian cells, DGK-epsilon shows specificity for arachidonyl-containing diacylglycerol. DGK-epsilon is expressed predominantly in testis. [provided by RefSeq, Jul 2008]
Mouse(56077) diacylglycerol kinase, epsilon
Rat(497978) diacylglycerol kinase, epsilon 64kDa
Zebrafish(100150463) diacylglycerol kinase epsilon
cow(538147) diacylglycerol kinase, epsilon 64kDa
Horse(100056676) diacylglycerol kinase, epsilon 64kDa
domestic cat(101101267) diacylglycerol kinase, epsilon 64kDa
dog(491102) diacylglycerol kinase, epsilon 64kDa
chicken(770911) diacylglycerol kinase, epsilon 64kDa
domestic guinea pig(100733591) diacylglycerol kinase, epsilon 64kDa
naked mole-rat(101708262) diacylglycerol kinase, epsilon 64kDa
sheep(101119735) diacylglycerol kinase, epsilon 64kDa
Domestic Rabbit(100358196) diacylglycerol kinase, epsilon 64kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003647 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003647 Rosetta Predictions human pricing
NM_001039341 Rosetta Predictions rat pricing
NM_019505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174766 predicted 1157
2 SASI_Hs02_00336012 predicted 1768
3 SASI_Hs02_00336013 predicted 849
4 SASI_Hs01_00174768 predicted 1692
5 SASI_Hs02_00336014 predicted 1293
6 SASI_Hs01_00174770 predicted 1811
7 SASI_Hs01_00174771 predicted 1674
8 SASI_Hs01_00174772 predicted 636
9 SASI_Hs02_00336015 predicted 1520
10 SASI_Hs01_00174774 predicted 1578
11 SASI_Hs01_00174767 predicted 1857
12 SASI_Hs01_00174769 predicted 1536
13 SASI_Hs01_00174773 predicted 1696
14 SASI_Hs01_00174775 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109704 predicted 712
2 SASI_Rn01_00109706 predicted 1393
3 SASI_Rn01_00109707 predicted 868
4 SASI_Rn02_00204821 predicted 814
5 SASI_Rn01_00109708 predicted 1205
6 SASI_Rn02_00204822 predicted 1269
7 SASI_Rn01_00109709 predicted 722
8 SASI_Rn01_00109710 predicted 722
9 SASI_Rn01_00109711 predicted 1254
10 SASI_Rn01_00109712 predicted 1189
11 SASI_Rn01_00109705 predicted 680
12 SASI_Rn01_00109713 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184856 predicted 961
2 SASI_Mm01_00184857 predicted 1063
3 SASI_Mm01_00184858 predicted 1741
4 SASI_Mm01_00184859 predicted 931
5 SASI_Mm02_00324542 predicted 1940
6 SASI_Mm01_00184860 predicted 921
7 SASI_Mm01_00184861 predicted 1461
8 SASI_Mm02_00324543 predicted 2007
9 SASI_Mm01_00184863 predicted 1557
10 SASI_Mm01_00184864 predicted 1373
11 SASI_Mm01_00184862 predicted 912
12 SASI_Mm01_00184865 predicted 1464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003647
VALIDATED
DGKE MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, epsilon 64kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003647.1-1829s1c1
Sequence:CCGGCGCAAGTAGATACATGTTCATCTCGAGATGAACATGTATCTACTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003647.1-853s1c1
Sequence:CCGGCCTCCTATCAAAGCCCTACAACTCGAGTTGTAGGGCTTTGATAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003647.1-1025s1c1
Sequence:CCGGGCAACGATCTATCCAATACATCTCGAGATGTATTGGATAGATCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003647.1-1524s1c1
Sequence:CCGGCGTTGGAGTATATGGGTCTTTCTCGAGAAAGACCCATATACTCCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003647.1-952s1c1
Sequence:CCGGGCAGTTGATGACATGAAGATTCTCGAGAATCTTCATGTCATCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003647.1-1873s1c1
Sequence:CCGGCTATCAGCTATTCAGTCTTAACTCGAGTTAAGACTGAATAGCTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003647.2-946s21c1
Sequence:CCGGCCTCCTATCAAAGCCCTACAACTCGAGTTGTAGGGCTTTGATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003647.2-1045s21c1
Sequence:CCGGGCAGTTGATGACATGAAGATTCTCGAGAATCTTCATGTCATCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003647.2-1617s21c1
Sequence:CCGGCGTTGGAGTATATGGGTCTTTCTCGAGAAAGACCCATATACTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003647.2-1922s21c1
Sequence:CCGGCGCAAGTAGATACATGTTCATCTCGAGATGAACATGTATCTACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003647
VALIDATED
DGKE MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, epsilon 64kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003647.1-1829s1c1
Sequence:CCGGCGCAAGTAGATACATGTTCATCTCGAGATGAACATGTATCTACTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003647.1-853s1c1
Sequence:CCGGCCTCCTATCAAAGCCCTACAACTCGAGTTGTAGGGCTTTGATAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003647.1-1025s1c1
Sequence:CCGGGCAACGATCTATCCAATACATCTCGAGATGTATTGGATAGATCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003647.1-1524s1c1
Sequence:CCGGCGTTGGAGTATATGGGTCTTTCTCGAGAAAGACCCATATACTCCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003647.1-952s1c1
Sequence:CCGGGCAGTTGATGACATGAAGATTCTCGAGAATCTTCATGTCATCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003647.1-1873s1c1
Sequence:CCGGCTATCAGCTATTCAGTCTTAACTCGAGTTAAGACTGAATAGCTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003647.2-946s21c1
Sequence:CCGGCCTCCTATCAAAGCCCTACAACTCGAGTTGTAGGGCTTTGATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003647.2-1045s21c1
Sequence:CCGGGCAGTTGATGACATGAAGATTCTCGAGAATCTTCATGTCATCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003647.2-1617s21c1
Sequence:CCGGCGTTGGAGTATATGGGTCTTTCTCGAGAAAGACCCATATACTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003647.2-1922s21c1
Sequence:CCGGCGCAAGTAGATACATGTTCATCTCGAGATGAACATGTATCTACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003647
VALIDATED
DGKE MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, epsilon 64kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003647.1-1829s1c1
Sequence:CCGGCGCAAGTAGATACATGTTCATCTCGAGATGAACATGTATCTACTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003647.1-853s1c1
Sequence:CCGGCCTCCTATCAAAGCCCTACAACTCGAGTTGTAGGGCTTTGATAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003647.1-1025s1c1
Sequence:CCGGGCAACGATCTATCCAATACATCTCGAGATGTATTGGATAGATCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003647.1-1524s1c1
Sequence:CCGGCGTTGGAGTATATGGGTCTTTCTCGAGAAAGACCCATATACTCCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003647.1-952s1c1
Sequence:CCGGGCAGTTGATGACATGAAGATTCTCGAGAATCTTCATGTCATCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003647.1-1873s1c1
Sequence:CCGGCTATCAGCTATTCAGTCTTAACTCGAGTTAAGACTGAATAGCTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003647.2-946s21c1
Sequence:CCGGCCTCCTATCAAAGCCCTACAACTCGAGTTGTAGGGCTTTGATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003647.2-1045s21c1
Sequence:CCGGGCAGTTGATGACATGAAGATTCTCGAGAATCTTCATGTCATCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003647.2-1617s21c1
Sequence:CCGGCGTTGGAGTATATGGGTCTTTCTCGAGAAAGACCCATATACTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003647.2-1922s21c1
Sequence:CCGGCGCAAGTAGATACATGTTCATCTCGAGATGAACATGTATCTACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019505
VALIDATED
DGKE MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, epsilon 64kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-556s1c1
Sequence:CCGGCCAAGCTACTTAACTTCTATTCTCGAGAATAGAAGTTAAGTAGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-432s1c1
Sequence:CCGGCCAGCCTAAACTGTGCGATTACTCGAGTAATCGCACAGTTTAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-1306s1c1
Sequence:CCGGCCTAACTTGGAGGGCATAATTCTCGAGAATTATGCCCTCCAAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-1515s1c1
Sequence:CCGGGCTGACTTTGAAGTGCTCCATCTCGAGATGGAGCACTTCAAAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-856s1c1
Sequence:CCGGGCCATTGATGAAATGAAGATTCTCGAGAATCTTCATTTCATCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019505.3-1343s21c1
Sequence:CCGGTTCCGGTTGCACAGGTCTTAACTCGAGTTAAGACCTGTGCAACCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019505.3-2025s21c1
Sequence:CCGGTTCGGATCATGAGGACGTAAACTCGAGTTTACGTCCTCATGATCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019505.3-1792s21c1
Sequence:CCGGGTTGGCGTCTATGGGTCTTTCCTCGAGGAAAGACCCATAGACGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019505.3-2119s21c1
Sequence:CCGGCGCCATTTCACTCCTAGTATTCTCGAGAATACTAGGAGTGAAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019505.3-919s21c1
Sequence:CCGGCCAAGCTACTTAACTTCTATTCTCGAGAATAGAAGTTAAGTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019505
VALIDATED
DGKE MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, epsilon 64kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-556s1c1
Sequence:CCGGCCAAGCTACTTAACTTCTATTCTCGAGAATAGAAGTTAAGTAGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-432s1c1
Sequence:CCGGCCAGCCTAAACTGTGCGATTACTCGAGTAATCGCACAGTTTAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-1306s1c1
Sequence:CCGGCCTAACTTGGAGGGCATAATTCTCGAGAATTATGCCCTCCAAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-1515s1c1
Sequence:CCGGGCTGACTTTGAAGTGCTCCATCTCGAGATGGAGCACTTCAAAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-856s1c1
Sequence:CCGGGCCATTGATGAAATGAAGATTCTCGAGAATCTTCATTTCATCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019505.3-1343s21c1
Sequence:CCGGTTCCGGTTGCACAGGTCTTAACTCGAGTTAAGACCTGTGCAACCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019505.3-2025s21c1
Sequence:CCGGTTCGGATCATGAGGACGTAAACTCGAGTTTACGTCCTCATGATCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019505.3-1792s21c1
Sequence:CCGGGTTGGCGTCTATGGGTCTTTCCTCGAGGAAAGACCCATAGACGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019505.3-2119s21c1
Sequence:CCGGCGCCATTTCACTCCTAGTATTCTCGAGAATACTAGGAGTGAAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019505.3-919s21c1
Sequence:CCGGCCAAGCTACTTAACTTCTATTCTCGAGAATAGAAGTTAAGTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019505
VALIDATED
DGKE MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, epsilon 64kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-556s1c1
Sequence:CCGGCCAAGCTACTTAACTTCTATTCTCGAGAATAGAAGTTAAGTAGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-432s1c1
Sequence:CCGGCCAGCCTAAACTGTGCGATTACTCGAGTAATCGCACAGTTTAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-1306s1c1
Sequence:CCGGCCTAACTTGGAGGGCATAATTCTCGAGAATTATGCCCTCCAAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-1515s1c1
Sequence:CCGGGCTGACTTTGAAGTGCTCCATCTCGAGATGGAGCACTTCAAAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019505.1-856s1c1
Sequence:CCGGGCCATTGATGAAATGAAGATTCTCGAGAATCTTCATTTCATCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019505.3-1343s21c1
Sequence:CCGGTTCCGGTTGCACAGGTCTTAACTCGAGTTAAGACCTGTGCAACCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019505.3-2025s21c1
Sequence:CCGGTTCGGATCATGAGGACGTAAACTCGAGTTTACGTCCTCATGATCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019505.3-1792s21c1
Sequence:CCGGGTTGGCGTCTATGGGTCTTTCCTCGAGGAAAGACCCATAGACGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019505.3-2119s21c1
Sequence:CCGGCGCCATTTCACTCCTAGTATTCTCGAGAATACTAGGAGTGAAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019505.3-919s21c1
Sequence:CCGGCCAAGCTACTTAACTTCTATTCTCGAGAATAGAAGTTAAGTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks