EMAIL THIS PAGE TO A FRIEND

DGKG

diacylglycerol kinase, gamma 90kDa

197 Gene Product Result for
Synonyms: DAGK3 DGK-GAMMA
UniProtKB ID: P49619, B2RAH4, Q2M1H4, Q5FWG1
Gene ID:
Human(1608) Summary: This gene encodes an enzyme that is a member of the type I subfamily of diacylglycerol kinases, which are involved in lipid metabolism. These enzymes generate phosphatidic acid by catalyzing the phosphorylation of diacylglycerol, a fundamental lipid second messenger that activates numerous proteins, including protein kinase C isoforms, Ras guanyl nucleotide-releasing proteins and some transient receptor potential channels. Diacylglycerol kinase gamma has been implicated in cell cycle regulation and in the negative regulation of macrophage differentiation in leukemia cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(110197) diacylglycerol kinase, gamma
Rat(25666) diacylglycerol kinase, gamma
chicken(424839) diacylglycerol kinase, gamma 90kDa
dog(488115) diacylglycerol kinase, gamma 90kDa
domestic cat(101100829) diacylglycerol kinase, gamma 90kDa
cow(518523) diacylglycerol kinase, gamma 90kDa
sheep(101114659) diacylglycerol kinase, gamma 90kDa
Domestic Rabbit(100344336) diacylglycerol kinase, gamma 90kDa
naked mole-rat(101726548) diacylglycerol kinase, gamma 90kDa
domestic guinea pig(100728276) diacylglycerol kinase, gamma 90kDa
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001346 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080744 Rosetta Predictions human pricing
NM_001080745 Rosetta Predictions human pricing
NM_001346 Rosetta Predictions human pricing
NM_013126 Rosetta Predictions rat pricing
NM_138650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315930 predicted 1017
2 SASI_Hs02_00315931 predicted 836
3 SASI_Hs02_00315932 predicted 681
4 SASI_Hs02_00315933 predicted 1242
5 SASI_Hs02_00315934 predicted 1245
6 SASI_Hs02_00315935 predicted 593
7 SASI_Hs02_00315936 predicted 849
8 SASI_Hs02_00315937 predicted 678
9 SASI_Hs02_00315938 predicted 2340
10 SASI_Hs02_00315939 predicted 2607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315940 predicted 1021
2 SASI_Hs02_00315941 predicted 841
3 SASI_Hs02_00315942 predicted 680
4 SASI_Hs02_00315943 predicted 1244
5 SASI_Hs02_00315944 predicted 1247
6 SASI_Hs02_00315945 predicted 592
7 SASI_Hs02_00315946 predicted 845
8 SASI_Hs02_00315947 predicted 682
9 SASI_Hs02_00315948 predicted 2298
10 SASI_Hs02_00315949 predicted 2570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331671 predicted 1023
2 SASI_Hs01_00021410 predicted 842
3 SASI_Hs01_00021411 predicted 680
4 SASI_Hs01_00021413 predicted 1244
5 SASI_Hs02_00331672 predicted 1245
6 SASI_Hs02_00331673 predicted 597
7 SASI_Hs01_00021414 predicted 848
8 SASI_Hs02_00331674 predicted 677
9 SASI_Hs01_00021415 predicted 2416
10 SASI_Hs01_00021416 predicted 2684
11 SASI_Hs01_00021412 predicted 1077
12 SASI_Hs01_00021417 predicted 1366
13 SASI_Hs01_00021418 predicted 1121
14 SASI_Hs01_00021419 predicted 2507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121545 predicted 606
2 SASI_Rn01_00121546 predicted 2181
3 SASI_Rn01_00121547 predicted 451
4 SASI_Rn01_00121548 predicted 1718
5 SASI_Rn01_00121549 predicted 1544
6 SASI_Rn01_00121550 predicted 1642
7 SASI_Rn02_00260907 predicted 763
8 SASI_Rn01_00121551 predicted 449
9 SASI_Rn02_00260908 predicted 2147
10 SASI_Rn01_00121553 predicted 831
11 SASI_Rn01_00121552 predicted 1233
12 SASI_Rn01_00121554 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339701 predicted 2521
2 SASI_Mm01_00123858 predicted 1703
3 SASI_Mm01_00123859 predicted 1391
4 SASI_Mm01_00123860 predicted 1789
5 SASI_Mm01_00123861 predicted 755
6 SASI_Mm01_00123863 predicted 981
7 SASI_Mm01_00123864 predicted 754
8 SASI_Mm01_00123865 predicted 1351
9 SASI_Mm01_00123866 predicted 2224
10 SASI_Mm01_00123867 predicted 2300
11 SASI_Mm01_00123862 predicted 1271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138650
DGKG MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, gamma 90kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138650.2-2287s21c1
Sequence:CCGGAGCTGTGGTATTTCGAATTTGCTCGAGCAAATTCGAAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138650.2-1559s21c1
Sequence:CCGGGATGACGTTTCACCGCAAATGCTCGAGCATTTGCGGTGAAACGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138650.2-2712s21c1
Sequence:CCGGCAGCCACAATGCACGATTAAACTCGAGTTTAATCGTGCATTGTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-2284s1c1
Sequence:CCGGGCAGCCACAATGCACGATTAACTCGAGTTAATCGTGCATTGTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-1442s1c1
Sequence:CCGGCCAGGATTGAACTTCTTTCATCTCGAGATGAAAGAAGTTCAATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-1744s1c1
Sequence:CCGGCCCATACAACATCATGAACAACTCGAGTTGTTCATGATGTTGTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-80s1c1
Sequence:CCGGCTCCAGAAATACTCTGAATATCTCGAGATATTCAGAGTATTTCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-919s1c1
Sequence:CCGGCCTGTGCTGCATCTACTGTAACTCGAGTTACAGTAGATGCAGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138650
DGKG MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, gamma 90kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138650.2-2287s21c1
Sequence:CCGGAGCTGTGGTATTTCGAATTTGCTCGAGCAAATTCGAAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138650.2-1559s21c1
Sequence:CCGGGATGACGTTTCACCGCAAATGCTCGAGCATTTGCGGTGAAACGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138650.2-2712s21c1
Sequence:CCGGCAGCCACAATGCACGATTAAACTCGAGTTTAATCGTGCATTGTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-2284s1c1
Sequence:CCGGGCAGCCACAATGCACGATTAACTCGAGTTAATCGTGCATTGTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-1442s1c1
Sequence:CCGGCCAGGATTGAACTTCTTTCATCTCGAGATGAAAGAAGTTCAATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-1744s1c1
Sequence:CCGGCCCATACAACATCATGAACAACTCGAGTTGTTCATGATGTTGTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-80s1c1
Sequence:CCGGCTCCAGAAATACTCTGAATATCTCGAGATATTCAGAGTATTTCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-919s1c1
Sequence:CCGGCCTGTGCTGCATCTACTGTAACTCGAGTTACAGTAGATGCAGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138650
DGKG MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, gamma 90kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138650.2-2287s21c1
Sequence:CCGGAGCTGTGGTATTTCGAATTTGCTCGAGCAAATTCGAAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138650.2-1559s21c1
Sequence:CCGGGATGACGTTTCACCGCAAATGCTCGAGCATTTGCGGTGAAACGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138650.2-2712s21c1
Sequence:CCGGCAGCCACAATGCACGATTAAACTCGAGTTTAATCGTGCATTGTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-2284s1c1
Sequence:CCGGGCAGCCACAATGCACGATTAACTCGAGTTAATCGTGCATTGTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-1442s1c1
Sequence:CCGGCCAGGATTGAACTTCTTTCATCTCGAGATGAAAGAAGTTCAATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-1744s1c1
Sequence:CCGGCCCATACAACATCATGAACAACTCGAGTTGTTCATGATGTTGTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-80s1c1
Sequence:CCGGCTCCAGAAATACTCTGAATATCTCGAGATATTCAGAGTATTTCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138650.1-919s1c1
Sequence:CCGGCCTGTGCTGCATCTACTGTAACTCGAGTTACAGTAGATGCAGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001346
DGKG MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, gamma 90kDa
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001346.1-2021s1c1
Sequence:CCGGGCATTGATAAGGCCAACTTTGCTCGAGCAAAGTTGGCCTTATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001346.1-1771s1c1
Sequence:CCGGGAACTTGTCATGCAGTATAAGCTCGAGCTTATACTGCATGACAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001346.1-2590s1c1
Sequence:CCGGGAACTGAAATTCTGCGTTCAACTCGAGTTGAACGCAGAATTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196338    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001346.1-3058s1c1
Sequence:CCGGGCCATACATTCTGTTTCAACACTCGAGTGTTGAAACAGAATGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-997s1c1
Sequence:CCGGCTGAAGGATGTTGTGTGCTACCTCGAGGTAGCACACAACATCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1954s1c1
Sequence:CCGGCGTGATACTCCAGACTTCCGTCTCGAGACGGAAGTCTGGAGTATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1063s1c1
Sequence:CCGGATGTTTCGCCTCTATGATTCACTCGAGTGAATCATAGAGGCGAAACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-2779s1c1
Sequence:CCGGCAGCCATGTTGCACGATTAAACTCGAGTTTAATCGTGCAACATGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1356s1c1
Sequence:CCGGGAAACCAACCTACTGCAACTTCTCGAGAAGTTGCAGTAGGTTGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001346.x-2908s1c1
Sequence:CCGGCCAGCTAAACCAAGAGAGAAACTCGAGTTTCTCTCTTGGTTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1957s1c1
Sequence:CCGGGATACTCCAGACTTCCGTGTTCTCGAGAACACGGAAGTCTGGAGTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1685s1c1
Sequence:CCGGACCACATCTTACTGCCCACCTCTCGAGAGGTGGGCAGTAAGATGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001346
DGKG MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, gamma 90kDa
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001346.1-2021s1c1
Sequence:CCGGGCATTGATAAGGCCAACTTTGCTCGAGCAAAGTTGGCCTTATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001346.1-1771s1c1
Sequence:CCGGGAACTTGTCATGCAGTATAAGCTCGAGCTTATACTGCATGACAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001346.1-2590s1c1
Sequence:CCGGGAACTGAAATTCTGCGTTCAACTCGAGTTGAACGCAGAATTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196338    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001346.1-3058s1c1
Sequence:CCGGGCCATACATTCTGTTTCAACACTCGAGTGTTGAAACAGAATGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-997s1c1
Sequence:CCGGCTGAAGGATGTTGTGTGCTACCTCGAGGTAGCACACAACATCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1954s1c1
Sequence:CCGGCGTGATACTCCAGACTTCCGTCTCGAGACGGAAGTCTGGAGTATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1063s1c1
Sequence:CCGGATGTTTCGCCTCTATGATTCACTCGAGTGAATCATAGAGGCGAAACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-2779s1c1
Sequence:CCGGCAGCCATGTTGCACGATTAAACTCGAGTTTAATCGTGCAACATGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1356s1c1
Sequence:CCGGGAAACCAACCTACTGCAACTTCTCGAGAAGTTGCAGTAGGTTGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001346.x-2908s1c1
Sequence:CCGGCCAGCTAAACCAAGAGAGAAACTCGAGTTTCTCTCTTGGTTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1957s1c1
Sequence:CCGGGATACTCCAGACTTCCGTGTTCTCGAGAACACGGAAGTCTGGAGTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1685s1c1
Sequence:CCGGACCACATCTTACTGCCCACCTCTCGAGAGGTGGGCAGTAAGATGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001346
DGKG MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, gamma 90kDa
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001346.1-2021s1c1
Sequence:CCGGGCATTGATAAGGCCAACTTTGCTCGAGCAAAGTTGGCCTTATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001346.1-1771s1c1
Sequence:CCGGGAACTTGTCATGCAGTATAAGCTCGAGCTTATACTGCATGACAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001346.1-2590s1c1
Sequence:CCGGGAACTGAAATTCTGCGTTCAACTCGAGTTGAACGCAGAATTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196338    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001346.1-3058s1c1
Sequence:CCGGGCCATACATTCTGTTTCAACACTCGAGTGTTGAAACAGAATGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-997s1c1
Sequence:CCGGCTGAAGGATGTTGTGTGCTACCTCGAGGTAGCACACAACATCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1954s1c1
Sequence:CCGGCGTGATACTCCAGACTTCCGTCTCGAGACGGAAGTCTGGAGTATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1063s1c1
Sequence:CCGGATGTTTCGCCTCTATGATTCACTCGAGTGAATCATAGAGGCGAAACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-2779s1c1
Sequence:CCGGCAGCCATGTTGCACGATTAAACTCGAGTTTAATCGTGCAACATGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1356s1c1
Sequence:CCGGGAAACCAACCTACTGCAACTTCTCGAGAAGTTGCAGTAGGTTGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001346.x-2908s1c1
Sequence:CCGGCCAGCTAAACCAAGAGAGAAACTCGAGTTTCTCTCTTGGTTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1957s1c1
Sequence:CCGGGATACTCCAGACTTCCGTGTTCTCGAGAACACGGAAGTCTGGAGTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001346.x-1685s1c1
Sequence:CCGGACCACATCTTACTGCCCACCTCTCGAGAGGTGGGCAGTAAGATGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks