EMAIL THIS PAGE TO A FRIEND

DGKH

diacylglycerol kinase, eta

190 Gene Product Result for
Synonyms: DGKeta
Gene ID:
Human(160851) Summary: This gene encodes a member of the diacylglycerol kinase (DGK) enzyme family of proteins, specifically the type II DGK subfamily. Members of this family are involved in regulating the intracellular concentrations of diacylglycerol and phosphatidic acid. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Mar 2011]
Mouse(380921) diacylglycerol kinase, eta
Rat(361076) diacylglycerol kinase, eta
domestic guinea pig(100736151) diacylglycerol kinase, eta
naked mole-rat(101698068) diacylglycerol kinase, eta
sheep(101108320) diacylglycerol kinase, eta
Domestic Rabbit(100341525) diacylglycerol kinase, eta
Zebrafish(100137124) diacylglycerol kinase, eta
chicken(769506) diacylglycerol kinase, eta
cow(537533) diacylglycerol kinase, eta
Horse(100060528) diacylglycerol kinase, eta
domestic cat(101087806) diacylglycerol kinase, eta
dog(476932) diacylglycerol kinase, eta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152910 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081336 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081336 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081336 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152910 Rosetta Predictions human pricing
NM_178009 Rosetta Predictions human pricing
XM_001072779 Rosetta Predictions rat pricing
XM_341358 Rosetta Predictions rat pricing
NM_001081336 Rosetta Predictions mouse pricing
XM_484397 Rosetta Predictions mouse pricing
XM_895030 Rosetta Predictions mouse pricing
XM_902438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366883 predicted 1327
2 SASI_Hs01_00105526 predicted 1001
3 SASI_Hs01_00105527 predicted 2333
4 SASI_Hs01_00105528 predicted 2484
5 SASI_Hs01_00105529 predicted 2751
6 SASI_Hs01_00105531 predicted 3170
7 SASI_Hs01_00105532 predicted 231
8 SASI_Hs01_00105533 predicted 1969
9 SASI_Hs01_00105534 predicted 1388
10 SASI_Hs02_00366884 predicted 2601
11 SASI_Hs01_00105525 predicted 2087
12 SASI_Hs01_00105530 predicted 2478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369481 predicted 1328
2 SASI_Hs01_00053149 predicted 1006
3 SASI_Hs01_00053150 predicted 2327
4 SASI_Hs01_00053151 predicted 2477
5 SASI_Hs01_00053152 predicted 2750
6 SASI_Hs01_00053154 predicted 3176
7 SASI_Hs01_00053155 predicted 225
8 SASI_Hs01_00053156 predicted 1966
9 SASI_Hs01_00053157 predicted 1390
10 SASI_Hs02_00369482 predicted 2600
11 SASI_Hs01_00053148 predicted 2093
12 SASI_Hs01_00053153 predicted 2478
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340477 predicted 2316
2 SASI_Rn02_00340478 predicted 2410
3 SASI_Rn02_00340479 predicted 1920
4 SASI_Rn02_00340480 predicted 2288
5 SASI_Rn02_00340481 predicted 367
6 SASI_Rn02_00340482 predicted 1927
7 SASI_Rn02_00340483 predicted 2964
8 SASI_Rn02_00340484 predicted 1616
9 SASI_Rn02_00340485 predicted 1195
10 SASI_Rn02_00340486 predicted 3309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184238 predicted 1108
2 SASI_Rn01_00184239 predicted 1363
3 SASI_Rn01_00184240 predicted 2351
4 SASI_Rn01_00184241 predicted 4403
5 SASI_Rn01_00184242 predicted 681
6 SASI_Rn01_00184243 predicted 4088
7 SASI_Rn01_00184244 predicted 3601
8 SASI_Rn01_00184245 predicted 3313
9 SASI_Rn01_00184246 predicted 749
10 SASI_Rn01_00184247 predicted 2299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297411 predicted 2640
2 SASI_Mm02_00297412 predicted 3446
3 SASI_Mm02_00297413 predicted 899
4 SASI_Mm02_00297414 predicted 472
5 SASI_Mm02_00297415 predicted 2287
6 SASI_Mm02_00297416 predicted 3118
7 SASI_Mm02_00297417 predicted 2477
8 SASI_Mm02_00297418 predicted 2968
9 SASI_Mm02_00297419 predicted 1834
10 SASI_Mm02_00297420 predicted 2886
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283744 predicted 2338
2 SASI_Mm01_00283745 predicted 3043
3 SASI_Mm01_00283746 predicted 3143
4 SASI_Mm01_00283747 predicted 598
5 SASI_Mm01_00283748 predicted 1981
6 SASI_Mm01_00283749 predicted 2819
7 SASI_Mm01_00283750 predicted 2171
8 SASI_Mm01_00283751 predicted 2662
9 SASI_Mm01_00283752 predicted 1520
10 SASI_Mm01_00283753 predicted 2583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273720 predicted 2642
2 SASI_Mm01_00273721 predicted 3358
3 SASI_Mm01_00273722 predicted 3452
4 SASI_Mm01_00273723 predicted 914
5 SASI_Mm01_00273724 predicted 472
6 SASI_Mm01_00273725 predicted 2293
7 SASI_Mm01_00273726 predicted 3131
8 SASI_Mm01_00273727 predicted 2483
9 SASI_Mm01_00273728 predicted 2978
10 SASI_Mm01_00273729 predicted 2896
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212403 predicted 3834
2 SASI_Mm01_00212404 predicted 3106
3 SASI_Mm01_00212405 predicted 3726
4 SASI_Mm01_00212406 predicted 3178
5 SASI_Mm01_00212407 predicted 2759
6 SASI_Mm01_00212408 predicted 2936
7 SASI_Mm01_00212409 predicted 3768
8 SASI_Mm01_00212410 predicted 2941
9 SASI_Mm01_00212411 predicted 3441
10 SASI_Mm01_00212412 predicted 3351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152910
VALIDATED
DGKH MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, eta
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152910.x-3539s1c1
Sequence:CCGGCAGTCGGAGGTGTAATCATATCTCGAGATATGATTACACCTCCGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152910.x-1652s1c1
Sequence:CCGGCCAGTAAATGTTCAGTCCTAACTCGAGTTAGGACTGAACATTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_152910.x-2303s1c1
Sequence:CCGGCCGTAGATGGATATTCAGAAACTCGAGTTTCTGAATATCCATCTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152910.x-204s1c1
Sequence:CCGGCCGGACCAAGACCAGTATTAACTCGAGTTAATACTGGTCTTGGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152910.x-3110s1c1
Sequence:CCGGCCCTGAATAAAGCCAACCCAACTCGAGTTGGGTTGGCTTTATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152910.3-3578s1c1
Sequence:CCGGGAGAAGTTATTGCCACTTAATCTCGAGATTAAGTGGCAATAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152910.3-3665s21c1
Sequence:CCGGGCACCTCTGTGGCTTGATATTCTCGAGAATATCAAGCCACAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_152910.3-2452s21c1
Sequence:CCGGCTTGGAACCCGGGAGTTATTACTCGAGTAATAACTCCCGGGTTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152910.3-203s21c1
Sequence:CCGGTCCGGACCAAGACCAGTATTACTCGAGTAATACTGGTCTTGGTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152910.3-2215s21c1
Sequence:CCGGATTGCTGGGAGTTCGATTATCCTCGAGGATAATCGAACTCCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152910.3-2267s21c1
Sequence:CCGGTTGGTGCCACGCCGTTTATTGCTCGAGCAATAAACGGCGTGGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152910.3-1380s21c1
Sequence:CCGGGTTGGACAGGTGGAGTATAATCTCGAGATTATACTCCACCTGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_152910.3-1124s21c1
Sequence:CCGGGAGGTCCTCATTTAGGTTTAACTCGAGTTAAACCTAAATGAGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152910.3-3540s21c1
Sequence:CCGGAGTCGGAGGTGTAATCATATTCTCGAGAATATGATTACACCTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152910
VALIDATED
DGKH MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, eta
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152910.x-3539s1c1
Sequence:CCGGCAGTCGGAGGTGTAATCATATCTCGAGATATGATTACACCTCCGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152910.x-1652s1c1
Sequence:CCGGCCAGTAAATGTTCAGTCCTAACTCGAGTTAGGACTGAACATTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_152910.x-2303s1c1
Sequence:CCGGCCGTAGATGGATATTCAGAAACTCGAGTTTCTGAATATCCATCTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152910.x-204s1c1
Sequence:CCGGCCGGACCAAGACCAGTATTAACTCGAGTTAATACTGGTCTTGGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152910.x-3110s1c1
Sequence:CCGGCCCTGAATAAAGCCAACCCAACTCGAGTTGGGTTGGCTTTATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152910.3-3578s1c1
Sequence:CCGGGAGAAGTTATTGCCACTTAATCTCGAGATTAAGTGGCAATAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152910.3-3665s21c1
Sequence:CCGGGCACCTCTGTGGCTTGATATTCTCGAGAATATCAAGCCACAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_152910.3-2452s21c1
Sequence:CCGGCTTGGAACCCGGGAGTTATTACTCGAGTAATAACTCCCGGGTTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152910.3-203s21c1
Sequence:CCGGTCCGGACCAAGACCAGTATTACTCGAGTAATACTGGTCTTGGTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152910.3-2215s21c1
Sequence:CCGGATTGCTGGGAGTTCGATTATCCTCGAGGATAATCGAACTCCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152910.3-2267s21c1
Sequence:CCGGTTGGTGCCACGCCGTTTATTGCTCGAGCAATAAACGGCGTGGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152910.3-1380s21c1
Sequence:CCGGGTTGGACAGGTGGAGTATAATCTCGAGATTATACTCCACCTGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_152910.3-1124s21c1
Sequence:CCGGGAGGTCCTCATTTAGGTTTAACTCGAGTTAAACCTAAATGAGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152910.3-3540s21c1
Sequence:CCGGAGTCGGAGGTGTAATCATATTCTCGAGAATATGATTACACCTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152910
VALIDATED
DGKH MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, eta
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152910.x-3539s1c1
Sequence:CCGGCAGTCGGAGGTGTAATCATATCTCGAGATATGATTACACCTCCGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152910.x-1652s1c1
Sequence:CCGGCCAGTAAATGTTCAGTCCTAACTCGAGTTAGGACTGAACATTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_152910.x-2303s1c1
Sequence:CCGGCCGTAGATGGATATTCAGAAACTCGAGTTTCTGAATATCCATCTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152910.x-204s1c1
Sequence:CCGGCCGGACCAAGACCAGTATTAACTCGAGTTAATACTGGTCTTGGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152910.x-3110s1c1
Sequence:CCGGCCCTGAATAAAGCCAACCCAACTCGAGTTGGGTTGGCTTTATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152910.3-3578s1c1
Sequence:CCGGGAGAAGTTATTGCCACTTAATCTCGAGATTAAGTGGCAATAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152910.3-3665s21c1
Sequence:CCGGGCACCTCTGTGGCTTGATATTCTCGAGAATATCAAGCCACAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_152910.3-2452s21c1
Sequence:CCGGCTTGGAACCCGGGAGTTATTACTCGAGTAATAACTCCCGGGTTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152910.3-203s21c1
Sequence:CCGGTCCGGACCAAGACCAGTATTACTCGAGTAATACTGGTCTTGGTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152910.3-2215s21c1
Sequence:CCGGATTGCTGGGAGTTCGATTATCCTCGAGGATAATCGAACTCCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152910.3-2267s21c1
Sequence:CCGGTTGGTGCCACGCCGTTTATTGCTCGAGCAATAAACGGCGTGGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152910.3-1380s21c1
Sequence:CCGGGTTGGACAGGTGGAGTATAATCTCGAGATTATACTCCACCTGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_152910.3-1124s21c1
Sequence:CCGGGAGGTCCTCATTTAGGTTTAACTCGAGTTAAACCTAAATGAGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152910.3-3540s21c1
Sequence:CCGGAGTCGGAGGTGTAATCATATTCTCGAGAATATGATTACACCTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358465
DGKH MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, eta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-216s1c1
Sequence:CCGGGATTTCTTTGTACTCTCCCAACTCGAGTTGGGAGAGTACAAAGAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-163s1c1
Sequence:CCGGTCTCGTCTTTCCAGATGCAAACTCGAGTTTGCATCTGGAAAGACGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-227s1c1
Sequence:CCGGACTCTCCCAAATTGAGCAGATCTCGAGATCTGCTCAATTTGGGAGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-341s1c1
Sequence:CCGGCTATGCGAAAGACTGTGCTTTCTCGAGAAAGCACAGTCTTTCGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-415s1c1
Sequence:CCGGAGGATGTAATAAAGCCAGGGACTCGAGTCCCTGGCTTTATTACATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358465
DGKH MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, eta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-216s1c1
Sequence:CCGGGATTTCTTTGTACTCTCCCAACTCGAGTTGGGAGAGTACAAAGAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-163s1c1
Sequence:CCGGTCTCGTCTTTCCAGATGCAAACTCGAGTTTGCATCTGGAAAGACGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-227s1c1
Sequence:CCGGACTCTCCCAAATTGAGCAGATCTCGAGATCTGCTCAATTTGGGAGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-341s1c1
Sequence:CCGGCTATGCGAAAGACTGTGCTTTCTCGAGAAAGCACAGTCTTTCGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-415s1c1
Sequence:CCGGAGGATGTAATAAAGCCAGGGACTCGAGTCCCTGGCTTTATTACATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358465
DGKH MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, eta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-216s1c1
Sequence:CCGGGATTTCTTTGTACTCTCCCAACTCGAGTTGGGAGAGTACAAAGAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-163s1c1
Sequence:CCGGTCTCGTCTTTCCAGATGCAAACTCGAGTTTGCATCTGGAAAGACGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-227s1c1
Sequence:CCGGACTCTCCCAAATTGAGCAGATCTCGAGATCTGCTCAATTTGGGAGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-341s1c1
Sequence:CCGGCTATGCGAAAGACTGTGCTTTCTCGAGAAAGCACAGTCTTTCGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358465.1-415s1c1
Sequence:CCGGAGGATGTAATAAAGCCAGGGACTCGAGTCCCTGGCTTTATTACATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081336
DGKH MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, eta
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000362959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081336.1-3625s21c1
Sequence:CCGGCACCTCTCCCGACTGATATTTCTCGAGAAATATCAGTCGGGAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081336.1-1087s21c1
Sequence:CCGGATGAACGGAGGGCCTTATTTACTCGAGTAAATAAGGCCCTCCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081336.1-1499s21c1
Sequence:CCGGATGAGCATGCGGTGGTCATATCTCGAGATATGACCACCGCATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081336.1-3132s21c1
Sequence:CCGGCAACGTCAAGGCGCTCTATAACTCGAGTTATAGAGCGCCTTGACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081336
DGKH MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, eta
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000362959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081336.1-3625s21c1
Sequence:CCGGCACCTCTCCCGACTGATATTTCTCGAGAAATATCAGTCGGGAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081336.1-1087s21c1
Sequence:CCGGATGAACGGAGGGCCTTATTTACTCGAGTAAATAAGGCCCTCCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081336.1-1499s21c1
Sequence:CCGGATGAGCATGCGGTGGTCATATCTCGAGATATGACCACCGCATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081336.1-3132s21c1
Sequence:CCGGCAACGTCAAGGCGCTCTATAACTCGAGTTATAGAGCGCCTTGACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081336
DGKH MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, eta
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000362959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081336.1-3625s21c1
Sequence:CCGGCACCTCTCCCGACTGATATTTCTCGAGAAATATCAGTCGGGAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081336.1-1087s21c1
Sequence:CCGGATGAACGGAGGGCCTTATTTACTCGAGTAAATAAGGCCCTCCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081336.1-1499s21c1
Sequence:CCGGATGAGCATGCGGTGGTCATATCTCGAGATATGACCACCGCATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081336.1-3132s21c1
Sequence:CCGGCAACGTCAAGGCGCTCTATAACTCGAGTTATAGAGCGCCTTGACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks