EMAIL THIS PAGE TO A FRIEND

DGKI

diacylglycerol kinase, iota

210 Gene Product Result for
Synonyms: DGK-IOTA
UniProtKB ID: O75912, A4D1Q9, Q9NZ49
Gene ID:
Human(9162) Summary: This gene is a member of the type IV diacylglycerol kinase subfamily. Diacylglycerol kinases regulate the intracellular concentration of diacylglycerol through its phosphorylation, producing phosphatidic acid. The specific role of the enzyme encoded by this gene is undetermined, however, it may play a crucial role in the production of phosphatidic acid in the retina or in recessive forms of retinal degeneration. [provided by RefSeq, Jul 2008]
Mouse(320127) diacylglycerol kinase, iota
Rat(688705) diacylglycerol kinase, iota
Zebrafish(100331649) diacylglycerol kinase, iota
chicken(418124) diacylglycerol kinase, iota
cow(530095) diacylglycerol kinase, iota
domestic cat(101088826) diacylglycerol kinase, iota
dog(482709) diacylglycerol kinase, iota
sheep(101108481) diacylglycerol kinase, iota
naked mole-rat(101706860) diacylglycerol kinase, iota
domestic guinea pig(100722467) diacylglycerol kinase, iota
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004717 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_284192 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284192 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284192 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_355752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004717 Rosetta Predictions human pricing
NM_198782 Rosetta Predictions rat pricing
XM_001067636 Rosetta Predictions rat pricing
XM_001067685 Rosetta Predictions rat pricing
XM_001067750 Rosetta Predictions rat pricing
NM_001081206 Rosetta Predictions mouse pricing
XM_355752 Rosetta Predictions mouse pricing
XM_896306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018895 predicted 2799
2 SASI_Hs01_00018896 predicted 1989
3 SASI_Hs01_00018897 predicted 1733
4 SASI_Hs01_00018899 predicted 1864
5 SASI_Hs02_00338182 predicted 1546
6 SASI_Hs01_00018900 predicted 656
7 SASI_Hs01_00018901 predicted 2690
8 SASI_Hs01_00018902 predicted 1795
9 SASI_Hs01_00018903 predicted 1719
10 SASI_Hs02_00338183 predicted 2817
11 SASI_Hs01_00018898 predicted 2707
12 SASI_Hs01_00018904 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270046 predicted 1864
2 SASI_Rn02_00270047 predicted 2666
3 SASI_Rn02_00270048 predicted 2122
4 SASI_Rn02_00270049 predicted 3397
5 SASI_Rn02_00270050 predicted 2019
6 SASI_Rn02_00270051 predicted 2284
7 SASI_Rn02_00270052 predicted 3470
8 SASI_Rn02_00270053 predicted 3023
9 SASI_Rn02_00270054 predicted 2976
10 SASI_Rn02_00270055 predicted 1779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321652 predicted 1189
2 SASI_Rn02_00321653 predicted 912
3 SASI_Rn02_00321654 predicted 1890
4 SASI_Rn02_00321655 predicted 1667
5 SASI_Rn02_00321656 predicted 1911
6 SASI_Rn02_00321657 predicted 1660
7 SASI_Rn02_00321658 predicted 1820
8 SASI_Rn02_00321659 predicted 1571
9 SASI_Rn02_00321660 predicted 1616
10 SASI_Rn02_00321661 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321835 predicted 1191
2 SASI_Rn02_00321836 predicted 909
3 SASI_Rn02_00321837 predicted 1888
4 SASI_Rn02_00321838 predicted 1659
5 SASI_Rn02_00321839 predicted 1913
6 SASI_Rn02_00321840 predicted 1658
7 SASI_Rn02_00321841 predicted 1819
8 SASI_Rn02_00321842 predicted 1573
9 SASI_Rn02_00321843 predicted 1615
10 SASI_Rn02_00321844 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322128 predicted 1061
2 SASI_Rn02_00322129 predicted 2544
3 SASI_Rn02_00322130 predicted 1771
4 SASI_Rn02_00322131 predicted 1083
5 SASI_Rn02_00322132 predicted 1022
6 SASI_Rn02_00322133 predicted 2801
7 SASI_Rn02_00322134 predicted 2667
8 SASI_Rn02_00322135 predicted 2759
9 SASI_Rn02_00322136 predicted 2799
10 SASI_Rn02_00322137 predicted 2704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296231 predicted 2560
2 SASI_Mm02_00296232 predicted 2577
3 SASI_Mm02_00296233 predicted 1278
4 SASI_Mm02_00296234 predicted 2408
5 SASI_Mm02_00296235 predicted 630
6 SASI_Mm02_00296236 predicted 2005
7 SASI_Mm02_00296237 predicted 2074
8 SASI_Mm02_00296238 predicted 1739
9 SASI_Mm02_00296239 predicted 1809
10 SASI_Mm02_00296240 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227612 predicted 2574
2 SASI_Mm01_00227613 predicted 2580
3 SASI_Mm01_00227614 predicted 1276
4 SASI_Mm01_00227615 predicted 2414
5 SASI_Mm01_00227616 predicted 2011
6 SASI_Mm01_00227617 predicted 2074
7 SASI_Mm01_00227618 predicted 1742
8 SASI_Mm01_00227619 predicted 1817
9 SASI_Mm01_00227620 predicted 908
10 SASI_Mm01_00227621 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212810 predicted 1050
2 SASI_Mm01_00212811 predicted 1059
3 SASI_Mm01_00212812 predicted 603
4 SASI_Mm01_00212813 predicted 675
5 SASI_Mm01_00212814 predicted 1103
6 SASI_Mm01_00212815 predicted 332
7 SASI_Mm01_00212816 predicted 406
8 SASI_Mm01_00212817 predicted 1304
9 SASI_Mm01_00212818 predicted 1285
10 SASI_Mm01_00212819 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081206
DGKI MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, iota
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081206.1-3324s21c1
Sequence:CCGGAGCTAATGGAATCCATATTTGCTCGAGCAAATATGGATTCCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081206.1-908s21c1
Sequence:CCGGTGCTTCATGCTGCATCATATTCTCGAGAATATGATGCAGCATGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081206.1-3624s21c1
Sequence:CCGGCTGTAACCACCCATCGATTTACTCGAGTAAATCGATGGGTGGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081206.1-1616s21c1
Sequence:CCGGTTTGATGCTCACGTCACATTGCTCGAGCAATGTGACGTGAGCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081206
DGKI MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, iota
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081206.1-3324s21c1
Sequence:CCGGAGCTAATGGAATCCATATTTGCTCGAGCAAATATGGATTCCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081206.1-908s21c1
Sequence:CCGGTGCTTCATGCTGCATCATATTCTCGAGAATATGATGCAGCATGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081206.1-3624s21c1
Sequence:CCGGCTGTAACCACCCATCGATTTACTCGAGTAAATCGATGGGTGGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081206.1-1616s21c1
Sequence:CCGGTTTGATGCTCACGTCACATTGCTCGAGCAATGTGACGTGAGCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081206
DGKI MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, iota
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081206.1-3324s21c1
Sequence:CCGGAGCTAATGGAATCCATATTTGCTCGAGCAAATATGGATTCCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081206.1-908s21c1
Sequence:CCGGTGCTTCATGCTGCATCATATTCTCGAGAATATGATGCAGCATGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081206.1-3624s21c1
Sequence:CCGGCTGTAACCACCCATCGATTTACTCGAGTAAATCGATGGGTGGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081206.1-1616s21c1
Sequence:CCGGTTTGATGCTCACGTCACATTGCTCGAGCAATGTGACGTGAGCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004717
DGKI MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, iota
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-2941s1c1
Sequence:CCGGCCACGGACCTTCCGAGTTATTCTCGAGAATAACTCGGAAGGTCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-660s1c1
Sequence:CCGGCCTGCATTGAGCAGCTAGAAACTCGAGTTTCTAGCTGCTCAATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004717.2-4150s1c1
Sequence:CCGGCAGGAAATGGAGCACTCTAACCTCGAGGTTAGAGTGCTCCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004717.2-4612s1c1
Sequence:CCGGCATTGGAATCTAGCCAGAAATCTCGAGATTTCTGGCTAGATTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004717.2-3512s1c1
Sequence:CCGGCAAAGGATGTTCGTATAAATGCTCGAGCATTTATACGAACATCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-2708s1c1
Sequence:CCGGCCCTATTATGAGGACTCAGATCTCGAGATCTGAGTCCTCATAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004717.2-4209s1c1
Sequence:CCGGGCACCCTAATTGACTTGGAAACTCGAGTTTCCAAGTCAATTAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-1833s1c1
Sequence:CCGGCCAGATATTGTGCTGGCACAACTCGAGTTGTGCCAGCACAATATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-1250s1c1
Sequence:CCGGGCGCTTGAATTGTATAGGAAACTCGAGTTTCCTATACAATTCAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-3149s1c1
Sequence:CCGGCGTCAGAACTATAAGGTCATTCTCGAGAATGACCTTATAGTTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004717
DGKI MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, iota
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-2941s1c1
Sequence:CCGGCCACGGACCTTCCGAGTTATTCTCGAGAATAACTCGGAAGGTCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-660s1c1
Sequence:CCGGCCTGCATTGAGCAGCTAGAAACTCGAGTTTCTAGCTGCTCAATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004717.2-4150s1c1
Sequence:CCGGCAGGAAATGGAGCACTCTAACCTCGAGGTTAGAGTGCTCCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004717.2-4612s1c1
Sequence:CCGGCATTGGAATCTAGCCAGAAATCTCGAGATTTCTGGCTAGATTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004717.2-3512s1c1
Sequence:CCGGCAAAGGATGTTCGTATAAATGCTCGAGCATTTATACGAACATCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-2708s1c1
Sequence:CCGGCCCTATTATGAGGACTCAGATCTCGAGATCTGAGTCCTCATAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004717.2-4209s1c1
Sequence:CCGGGCACCCTAATTGACTTGGAAACTCGAGTTTCCAAGTCAATTAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-1833s1c1
Sequence:CCGGCCAGATATTGTGCTGGCACAACTCGAGTTGTGCCAGCACAATATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-1250s1c1
Sequence:CCGGGCGCTTGAATTGTATAGGAAACTCGAGTTTCCTATACAATTCAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-3149s1c1
Sequence:CCGGCGTCAGAACTATAAGGTCATTCTCGAGAATGACCTTATAGTTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004717
DGKI MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, iota
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-2941s1c1
Sequence:CCGGCCACGGACCTTCCGAGTTATTCTCGAGAATAACTCGGAAGGTCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-660s1c1
Sequence:CCGGCCTGCATTGAGCAGCTAGAAACTCGAGTTTCTAGCTGCTCAATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004717.2-4150s1c1
Sequence:CCGGCAGGAAATGGAGCACTCTAACCTCGAGGTTAGAGTGCTCCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004717.2-4612s1c1
Sequence:CCGGCATTGGAATCTAGCCAGAAATCTCGAGATTTCTGGCTAGATTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004717.2-3512s1c1
Sequence:CCGGCAAAGGATGTTCGTATAAATGCTCGAGCATTTATACGAACATCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-2708s1c1
Sequence:CCGGCCCTATTATGAGGACTCAGATCTCGAGATCTGAGTCCTCATAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004717.2-4209s1c1
Sequence:CCGGGCACCCTAATTGACTTGGAAACTCGAGTTTCCAAGTCAATTAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-1833s1c1
Sequence:CCGGCCAGATATTGTGCTGGCACAACTCGAGTTGTGCCAGCACAATATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-1250s1c1
Sequence:CCGGGCGCTTGAATTGTATAGGAAACTCGAGTTTCCTATACAATTCAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004717.2-3149s1c1
Sequence:CCGGCGTCAGAACTATAAGGTCATTCTCGAGAATGACCTTATAGTTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284192
DGKI MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, iota
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000025434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284192.1-858s1c1
Sequence:CCGGCCTCTGGGTATTCTAGTTGTTCTCGAGAACAACTAGAATACCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284192.1-514s1c1
Sequence:CCGGGCTACATTGAAGTCATTGGATCTCGAGATCCAATGACTTCAATGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284192.1-1358s1c1
Sequence:CCGGGAAATCATCTTATCTGCCCATCTCGAGATGGGCAGATAAGATGATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284192.1-906s1c1
Sequence:CCGGCGTATGTACATAGACCGTCTACTCGAGTAGACGGTCTATGTACATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284192
DGKI MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, iota
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000025434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284192.1-858s1c1
Sequence:CCGGCCTCTGGGTATTCTAGTTGTTCTCGAGAACAACTAGAATACCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284192.1-514s1c1
Sequence:CCGGGCTACATTGAAGTCATTGGATCTCGAGATCCAATGACTTCAATGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284192.1-1358s1c1
Sequence:CCGGGAAATCATCTTATCTGCCCATCTCGAGATGGGCAGATAAGATGATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284192.1-906s1c1
Sequence:CCGGCGTATGTACATAGACCGTCTACTCGAGTAGACGGTCTATGTACATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284192
DGKI MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, iota
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000025434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284192.1-858s1c1
Sequence:CCGGCCTCTGGGTATTCTAGTTGTTCTCGAGAACAACTAGAATACCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284192.1-514s1c1
Sequence:CCGGGCTACATTGAAGTCATTGGATCTCGAGATCCAATGACTTCAATGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284192.1-1358s1c1
Sequence:CCGGGAAATCATCTTATCTGCCCATCTCGAGATGGGCAGATAAGATGATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284192.1-906s1c1
Sequence:CCGGCGTATGTACATAGACCGTCTACTCGAGTAGACGGTCTATGTACATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355752
DGKI MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, iota
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-369s1c1
Sequence:CCGGGAAGCAGGTCTCTTACAGGAACTCGAGTTCCTGTAAGAGACCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-310s1c1
Sequence:CCGGGCCGGACAGAAAGAGAAGGAACTCGAGTTCCTTCTCTTTCTGTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-895s1c1
Sequence:CCGGTGGATCATTAAGGTGAAGAAACTCGAGTTTCTTCACCTTAATGATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-652s1c1
Sequence:CCGGGAGCAACTAGAGAAGAACTTTCTCGAGAAAGTTCTTCTCTAGTTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-821s1c1
Sequence:CCGGCCTGCTTCATGCTGCATCATACTCGAGTATGATGCAGCATGAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355752
DGKI MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, iota
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-369s1c1
Sequence:CCGGGAAGCAGGTCTCTTACAGGAACTCGAGTTCCTGTAAGAGACCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-310s1c1
Sequence:CCGGGCCGGACAGAAAGAGAAGGAACTCGAGTTCCTTCTCTTTCTGTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-895s1c1
Sequence:CCGGTGGATCATTAAGGTGAAGAAACTCGAGTTTCTTCACCTTAATGATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-652s1c1
Sequence:CCGGGAGCAACTAGAGAAGAACTTTCTCGAGAAAGTTCTTCTCTAGTTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-821s1c1
Sequence:CCGGCCTGCTTCATGCTGCATCATACTCGAGTATGATGCAGCATGAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355752
DGKI MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, iota
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-369s1c1
Sequence:CCGGGAAGCAGGTCTCTTACAGGAACTCGAGTTCCTGTAAGAGACCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-310s1c1
Sequence:CCGGGCCGGACAGAAAGAGAAGGAACTCGAGTTCCTTCTCTTTCTGTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-895s1c1
Sequence:CCGGTGGATCATTAAGGTGAAGAAACTCGAGTTTCTTCACCTTAATGATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-652s1c1
Sequence:CCGGGAGCAACTAGAGAAGAACTTTCTCGAGAAAGTTCTTCTCTAGTTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355752.1-821s1c1
Sequence:CCGGCCTGCTTCATGCTGCATCATACTCGAGTATGATGCAGCATGAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks