EMAIL THIS PAGE TO A FRIEND

DGKK

diacylglycerol kinase, kappa

65 Gene Product Result for
UniProtKB ID: Q5KSL6, B2RP91
Gene ID:
Human(139189) Summary: The protein encoded by this gene is an enzyme that phosphorylates diacylglycerol, converting it to phosphatidic acid. The encoded protein is a membrane protein and is inhibited by hydrogen peroxide. Variations in this gene have been associated with hypospadias. [provided by RefSeq, Mar 2011]
Mouse(331374) diacylglycerol kinase kappa
Rat(367745) diacylglycerol kinase kappa
domestic guinea pig(100713423) diacylglycerol kinase, kappa
naked mole-rat(101726645) diacylglycerol kinase, kappa
sheep(101110739) diacylglycerol kinase, kappa
Domestic Rabbit(100356666) diacylglycerol kinase, kappa
chicken(422129) diacylglycerol kinase, kappa
dog(491884) diacylglycerol kinase, kappa
cow(538185) diacylglycerol kinase, kappa
Horse(100063191) diacylglycerol kinase, kappa
domestic cat(101085603) diacylglycerol kinase, kappa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300744 Anti-DGKK antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB1305400 ANTI-DGKK(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB4500463 Anti-DGKK, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_066534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_066534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_066534 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013742 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU058851 MISSION® esiRNA esiRNA targeting mouse Dgkk (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013742 Rosetta Predictions human pricing
XM_001064508 Rosetta Predictions rat pricing
XM_346276 Rosetta Predictions rat pricing
NM_177914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024250 predicted 1716
2 SASI_Hs01_00024251 predicted 1792
3 SASI_Hs01_00024252 predicted 3047
4 SASI_Hs01_00024253 predicted 1598
5 SASI_Hs02_00306489 predicted 1179
6 SASI_Hs01_00024255 predicted 682
7 SASI_Hs01_00024256 predicted 3692
8 SASI_Hs01_00024257 predicted 727
9 SASI_Hs01_00024258 predicted 867
10 SASI_Hs01_00024259 predicted 2704
11 SASI_Hs01_00024254 predicted 2439
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310799 predicted 3075
2 SASI_Rn02_00310800 predicted 3793
3 SASI_Rn02_00310801 predicted 3929
4 SASI_Rn02_00310802 predicted 1278
5 SASI_Rn02_00310803 predicted 3974
6 SASI_Rn02_00310804 predicted 2820
7 SASI_Rn02_00310805 predicted 2938
8 SASI_Rn02_00310806 predicted 1764
9 SASI_Rn02_00310807 predicted 3778
10 SASI_Rn02_00310808 predicted 2675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399203 predicted 2123
2 SASI_Rn02_00399204 predicted 2839
3 SASI_Rn02_00399205 predicted 2981
4 SASI_Rn02_00399206 predicted 327
5 SASI_Rn02_00399207 predicted 3027
6 SASI_Rn02_00399208 predicted 1865
7 SASI_Rn02_00399209 predicted 1985
8 SASI_Rn02_00399210 predicted 1058
9 SASI_Rn02_00399211 predicted 814
10 SASI_Rn02_00399212 predicted 2827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348397 predicted 2398
2 SASI_Mm01_00138900 predicted 2963
3 SASI_Mm01_00138905 predicted 3267
4 SASI_Mm01_00138906 predicted 518
5 SASI_Mm02_00348398 predicted 2415
6 SASI_Mm02_00348399 predicted 2278
7 SASI_Mm01_00138907 predicted 436
8 SASI_Mm01_00138908 predicted 277
9 SASI_Mm02_00348400 predicted 2230
10 SASI_Mm01_00138909 predicted 3113
11 SASI_Mm01_00138901 predicted 3136
12 SASI_Mm01_00138902 predicted 2593
13 SASI_Mm01_00138903 predicted 2022
14 SASI_Mm01_00138904 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177914
DGKK MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, kappa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177914.2-3633s1c1
Sequence:CCGGCCCTCCAAATCCTTATACTAACTCGAGTTAGTATAAGGATTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177914.2-498s1c1
Sequence:CCGGGCAGAAATCTTTGCCATGGTTCTCGAGAACCATGGCAAAGATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177914.2-3449s1c1
Sequence:CCGGCGTCGAAGAAATCGTAGCAATCTCGAGATTGCTACGATTTCTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177914.2-1217s1c1
Sequence:CCGGCGGAAATTCAAACAATACCTTCTCGAGAAGGTATTGTTTGAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177914.2-307s1c1
Sequence:CCGGGCCAATAACGTGGTCCAGAATCTCGAGATTCTGGACCACGTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177914
DGKK MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, kappa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177914.2-3633s1c1
Sequence:CCGGCCCTCCAAATCCTTATACTAACTCGAGTTAGTATAAGGATTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177914.2-498s1c1
Sequence:CCGGGCAGAAATCTTTGCCATGGTTCTCGAGAACCATGGCAAAGATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177914.2-3449s1c1
Sequence:CCGGCGTCGAAGAAATCGTAGCAATCTCGAGATTGCTACGATTTCTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177914.2-1217s1c1
Sequence:CCGGCGGAAATTCAAACAATACCTTCTCGAGAAGGTATTGTTTGAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177914.2-307s1c1
Sequence:CCGGGCCAATAACGTGGTCCAGAATCTCGAGATTCTGGACCACGTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177914
DGKK MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, kappa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177914.2-3633s1c1
Sequence:CCGGCCCTCCAAATCCTTATACTAACTCGAGTTAGTATAAGGATTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177914.2-498s1c1
Sequence:CCGGGCAGAAATCTTTGCCATGGTTCTCGAGAACCATGGCAAAGATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177914.2-3449s1c1
Sequence:CCGGCGTCGAAGAAATCGTAGCAATCTCGAGATTGCTACGATTTCTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177914.2-1217s1c1
Sequence:CCGGCGGAAATTCAAACAATACCTTCTCGAGAAGGTATTGTTTGAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177914.2-307s1c1
Sequence:CCGGGCCAATAACGTGGTCCAGAATCTCGAGATTCTGGACCACGTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_066534
DGKK MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, kappa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-1927s1c1
Sequence:CCGGCCTGAATCTATACGCTTCAAACTCGAGTTTGAAGCGTATAGATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-940s1c1
Sequence:CCGGCCATCTCAAGTGTTCGACTTACTCGAGTAAGTCGAACACTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-2037s1c1
Sequence:CCGGGCAATACAATAGCCGCCTTAACTCGAGTTAAGGCGGCTATTGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-2851s1c1
Sequence:CCGGGCCATGAATAAGGAGTTCAAACTCGAGTTTGAACTCCTTATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-369s1c1
Sequence:CCGGGCATTGTTGGTACTCCAGTTACTCGAGTAACTGGAGTACCAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_066534
DGKK MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, kappa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-1927s1c1
Sequence:CCGGCCTGAATCTATACGCTTCAAACTCGAGTTTGAAGCGTATAGATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-940s1c1
Sequence:CCGGCCATCTCAAGTGTTCGACTTACTCGAGTAAGTCGAACACTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-2037s1c1
Sequence:CCGGGCAATACAATAGCCGCCTTAACTCGAGTTAAGGCGGCTATTGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-2851s1c1
Sequence:CCGGGCCATGAATAAGGAGTTCAAACTCGAGTTTGAACTCCTTATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-369s1c1
Sequence:CCGGGCATTGTTGGTACTCCAGTTACTCGAGTAACTGGAGTACCAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_066534
DGKK MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, kappa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-1927s1c1
Sequence:CCGGCCTGAATCTATACGCTTCAAACTCGAGTTTGAAGCGTATAGATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-940s1c1
Sequence:CCGGCCATCTCAAGTGTTCGACTTACTCGAGTAAGTCGAACACTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-2037s1c1
Sequence:CCGGGCAATACAATAGCCGCCTTAACTCGAGTTAAGGCGGCTATTGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-2851s1c1
Sequence:CCGGGCCATGAATAAGGAGTTCAAACTCGAGTTTGAACTCCTTATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_066534.2-369s1c1
Sequence:CCGGGCATTGTTGGTACTCCAGTTACTCGAGTAACTGGAGTACCAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013742
DGKK MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, kappa
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013742.1-2570s21c1
Sequence:CCGGACCTTAACTTGGATCACTTACCTCGAGGTAAGTGATCCAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013742.1-1343s21c1
Sequence:CCGGTCCGCTGCCTGTGGTGTAATTCTCGAGAATTACACCACAGGCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013742.1-1613s21c1
Sequence:CCGGCATCTCAAGTGTTCGACTTATCTCGAGATAAGTCGAACACTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013742
DGKK MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, kappa
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013742.1-2570s21c1
Sequence:CCGGACCTTAACTTGGATCACTTACCTCGAGGTAAGTGATCCAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013742.1-1343s21c1
Sequence:CCGGTCCGCTGCCTGTGGTGTAATTCTCGAGAATTACACCACAGGCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013742.1-1613s21c1
Sequence:CCGGCATCTCAAGTGTTCGACTTATCTCGAGATAAGTCGAACACTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013742
DGKK MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, kappa
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000360252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013742.1-2570s21c1
Sequence:CCGGACCTTAACTTGGATCACTTACCTCGAGGTAAGTGATCCAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013742.1-1343s21c1
Sequence:CCGGTCCGCTGCCTGTGGTGTAATTCTCGAGAATTACACCACAGGCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013742.1-1613s21c1
Sequence:CCGGCATCTCAAGTGTTCGACTTATCTCGAGATAAGTCGAACACTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks