EMAIL THIS PAGE TO A FRIEND

DGKQ

diacylglycerol kinase, theta 110kDa

48 Gene Product Result for
Synonyms: DAGK DAGK4 DAGK7
UniProtKB ID: P52824, Q6P3W4
Gene ID:
Human(1609) Summary: The protein encoded by this gene contains three cysteine-rich domains, a proline-rich region, and a pleckstrin homology domain with an overlapping Ras-associating domain. It is localized in the speckle domains of the nucleus, and mediates the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. [provided by RefSeq, Jul 2008]
Mouse(110524) diacylglycerol kinase, theta
Rat(100361138) diacylglycerol kinase, theta
chicken(427381) diacylglycerol kinase, theta 110kDa
cow(518371) diacylglycerol kinase, theta 110kDa
domestic cat(101096148) diacylglycerol kinase, theta 110kDa
dog(488867) diacylglycerol kinase, theta 110kDa
sheep(101106172) diacylglycerol kinase, theta 110kDa
naked mole-rat(101726134) diacylglycerol kinase, theta 110kDa
domestic guinea pig(100731359) diacylglycerol kinase, theta 110kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001347 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001347 Rosetta Predictions human pricing
NM_199011 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096384 predicted 1917
2 SASI_Hs01_00096385 predicted 3115
3 SASI_Hs01_00096387 predicted 2498
4 SASI_Hs01_00096388 predicted 1437
5 SASI_Hs01_00096389 predicted 2678
6 SASI_Hs01_00096390 predicted 3074
7 SASI_Hs01_00096392 predicted 467
8 SASI_Hs01_00096393 predicted 546
9 SASI_Hs02_00331675 predicted 1473
10 SASI_Hs02_00331676 predicted 2430
11 SASI_Hs01_00096386 predicted 2357
12 SASI_Hs01_00096391 predicted 2349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143514 predicted 2475
2 SASI_Mm01_00143515 predicted 2555
3 SASI_Mm01_00143516 predicted 751
4 SASI_Mm01_00143517 predicted 2258
5 SASI_Mm01_00143518 predicted 1350
6 SASI_Mm01_00143519 predicted 1064
7 SASI_Mm01_00143520 predicted 2277
8 SASI_Mm01_00143521 predicted 2195
9 SASI_Mm01_00143522 predicted 1658
10 SASI_Mm01_00143523 predicted 653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199011
DGKQ MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, theta 110kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199011.1-1056s21c1
Sequence:CCGGGCACTTCGGGCCTACTATATTCTCGAGAATATAGTAGGCCCGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199011.1-3031s21c1
Sequence:CCGGGTGGGTAGGTAATGGTCATTACTCGAGTAATGACCATTACCTACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199011.1-574s21c1
Sequence:CCGGAGGATGGACAGCAGGATTATGCTCGAGCATAATCCTGCTGTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199011.1-1155s21c1
Sequence:CCGGACTGAGGAGGAGGCTAGTAAACTCGAGTTTACTAGCCTCCTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-2259s1c1
Sequence:CCGGCCCAAGATTGTTCAGATGAATCTCGAGATTCATCTGAACAATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-1657s1c1
Sequence:CCGGACTCCTTACAAGGTGCAGTAACTCGAGTTACTGCACCTTGTAAGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-1332s1c1
Sequence:CCGGCAAGAGGTTCTCCCACTGTTTCTCGAGAAACAGTGGGAGAACCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-2786s1c1
Sequence:CCGGGCTGAGAAAGGCTAAGCAGAACTCGAGTTCTGCTTAGCCTTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-582s1c1
Sequence:CCGGCAGCAGGATTATGACACGTATCTCGAGATACGTGTCATAATCCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199011
DGKQ MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, theta 110kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199011.1-1056s21c1
Sequence:CCGGGCACTTCGGGCCTACTATATTCTCGAGAATATAGTAGGCCCGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199011.1-3031s21c1
Sequence:CCGGGTGGGTAGGTAATGGTCATTACTCGAGTAATGACCATTACCTACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199011.1-574s21c1
Sequence:CCGGAGGATGGACAGCAGGATTATGCTCGAGCATAATCCTGCTGTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199011.1-1155s21c1
Sequence:CCGGACTGAGGAGGAGGCTAGTAAACTCGAGTTTACTAGCCTCCTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-2259s1c1
Sequence:CCGGCCCAAGATTGTTCAGATGAATCTCGAGATTCATCTGAACAATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-1657s1c1
Sequence:CCGGACTCCTTACAAGGTGCAGTAACTCGAGTTACTGCACCTTGTAAGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-1332s1c1
Sequence:CCGGCAAGAGGTTCTCCCACTGTTTCTCGAGAAACAGTGGGAGAACCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-2786s1c1
Sequence:CCGGGCTGAGAAAGGCTAAGCAGAACTCGAGTTCTGCTTAGCCTTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-582s1c1
Sequence:CCGGCAGCAGGATTATGACACGTATCTCGAGATACGTGTCATAATCCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199011
DGKQ MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, theta 110kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199011.1-1056s21c1
Sequence:CCGGGCACTTCGGGCCTACTATATTCTCGAGAATATAGTAGGCCCGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199011.1-3031s21c1
Sequence:CCGGGTGGGTAGGTAATGGTCATTACTCGAGTAATGACCATTACCTACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199011.1-574s21c1
Sequence:CCGGAGGATGGACAGCAGGATTATGCTCGAGCATAATCCTGCTGTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199011.1-1155s21c1
Sequence:CCGGACTGAGGAGGAGGCTAGTAAACTCGAGTTTACTAGCCTCCTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-2259s1c1
Sequence:CCGGCCCAAGATTGTTCAGATGAATCTCGAGATTCATCTGAACAATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-1657s1c1
Sequence:CCGGACTCCTTACAAGGTGCAGTAACTCGAGTTACTGCACCTTGTAAGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-1332s1c1
Sequence:CCGGCAAGAGGTTCTCCCACTGTTTCTCGAGAAACAGTGGGAGAACCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-2786s1c1
Sequence:CCGGGCTGAGAAAGGCTAAGCAGAACTCGAGTTCTGCTTAGCCTTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199011.1-582s1c1
Sequence:CCGGCAGCAGGATTATGACACGTATCTCGAGATACGTGTCATAATCCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001347
VALIDATED
DGKQ MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, theta 110kDa
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001347.2-964s21c1
Sequence:CCGGAGCAAACGCTGAAGATCTTTGCTCGAGCAAAGATCTTCAGCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001347.2-1446s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001347.2-4195s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001347.2-3770s21c1
Sequence:CCGGAGGAGTTTGGGAGGTGTAAACCTCGAGGTTTACACCTCCCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001347.2-2290s21c1
Sequence:CCGGTCGTGCAGATGAGTAACTACTCTCGAGAGTAGTTACTCATCTGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001347.2-1448s21c1
Sequence:CCGGGACGATGCTGATGGACGAACACTCGAGTGTTCGTCCATCAGCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001347.2-336s21c1
Sequence:CCGGCTGTGCGACGTCTGCAATTTCCTCGAGGAAATTGCAGACGTCGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001347.2-4346s1c1
Sequence:CCGGGCACAGACACACGCATTGTAACTCGAGTTACAATGCGTGTGTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001347.2-1902s1c1
Sequence:CCGGCGGAAGCTACTGAACCCTCATCTCGAGATGAGGGTTCAGTAGCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001347.2-1671s1c1
Sequence:CCGGAGTCACATCTACTCCTCCCAACTCGAGTTGGGAGGAGTAGATGTGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_001347.2-959s1c1
Sequence:CCGGCGGGAAGCAAACGCTGAAGATCTCGAGATCTTCAGCGTTTGCTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001347.2-2297s1c1
Sequence:CCGGGATGAGTAACTACTGTGGCATCTCGAGATGCCACAGTAGTTACTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001347.2-3068s1c1
Sequence:CCGGCTCATCCCATTGGTGACACATCTCGAGATGTGTCACCAATGGGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001347.2-350s1c1
Sequence:CCGGCAATTTCATGTCTCATGAGAACTCGAGTTCTCATGAGACATGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001347
VALIDATED
DGKQ MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, theta 110kDa
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001347.2-964s21c1
Sequence:CCGGAGCAAACGCTGAAGATCTTTGCTCGAGCAAAGATCTTCAGCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001347.2-1446s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001347.2-4195s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001347.2-3770s21c1
Sequence:CCGGAGGAGTTTGGGAGGTGTAAACCTCGAGGTTTACACCTCCCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001347.2-2290s21c1
Sequence:CCGGTCGTGCAGATGAGTAACTACTCTCGAGAGTAGTTACTCATCTGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001347.2-1448s21c1
Sequence:CCGGGACGATGCTGATGGACGAACACTCGAGTGTTCGTCCATCAGCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001347.2-336s21c1
Sequence:CCGGCTGTGCGACGTCTGCAATTTCCTCGAGGAAATTGCAGACGTCGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001347.2-4346s1c1
Sequence:CCGGGCACAGACACACGCATTGTAACTCGAGTTACAATGCGTGTGTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001347.2-1902s1c1
Sequence:CCGGCGGAAGCTACTGAACCCTCATCTCGAGATGAGGGTTCAGTAGCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001347.2-1671s1c1
Sequence:CCGGAGTCACATCTACTCCTCCCAACTCGAGTTGGGAGGAGTAGATGTGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_001347.2-959s1c1
Sequence:CCGGCGGGAAGCAAACGCTGAAGATCTCGAGATCTTCAGCGTTTGCTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001347.2-2297s1c1
Sequence:CCGGGATGAGTAACTACTGTGGCATCTCGAGATGCCACAGTAGTTACTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001347.2-3068s1c1
Sequence:CCGGCTCATCCCATTGGTGACACATCTCGAGATGTGTCACCAATGGGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001347.2-350s1c1
Sequence:CCGGCAATTTCATGTCTCATGAGAACTCGAGTTCTCATGAGACATGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001347
VALIDATED
DGKQ MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, theta 110kDa
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001347.2-964s21c1
Sequence:CCGGAGCAAACGCTGAAGATCTTTGCTCGAGCAAAGATCTTCAGCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001347.2-1446s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001347.2-4195s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001347.2-3770s21c1
Sequence:CCGGAGGAGTTTGGGAGGTGTAAACCTCGAGGTTTACACCTCCCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001347.2-2290s21c1
Sequence:CCGGTCGTGCAGATGAGTAACTACTCTCGAGAGTAGTTACTCATCTGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001347.2-1448s21c1
Sequence:CCGGGACGATGCTGATGGACGAACACTCGAGTGTTCGTCCATCAGCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001347.2-336s21c1
Sequence:CCGGCTGTGCGACGTCTGCAATTTCCTCGAGGAAATTGCAGACGTCGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001347.2-4346s1c1
Sequence:CCGGGCACAGACACACGCATTGTAACTCGAGTTACAATGCGTGTGTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001347.2-1902s1c1
Sequence:CCGGCGGAAGCTACTGAACCCTCATCTCGAGATGAGGGTTCAGTAGCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001347.2-1671s1c1
Sequence:CCGGAGTCACATCTACTCCTCCCAACTCGAGTTGGGAGGAGTAGATGTGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_001347.2-959s1c1
Sequence:CCGGCGGGAAGCAAACGCTGAAGATCTCGAGATCTTCAGCGTTTGCTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001347.2-2297s1c1
Sequence:CCGGGATGAGTAACTACTGTGGCATCTCGAGATGCCACAGTAGTTACTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001347.2-3068s1c1
Sequence:CCGGCTCATCCCATTGGTGACACATCTCGAGATGTGTCACCAATGGGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001347.2-350s1c1
Sequence:CCGGCAATTTCATGTCTCATGAGAACTCGAGTTCTCATGAGACATGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks