EMAIL THIS PAGE TO A FRIEND

DGKZ

diacylglycerol kinase, zeta

111 Gene Product Result for
Synonyms: DAGK5 DAGK6 DGK-ZETA hDGKzeta
Gene ID:
Human(8525) Summary: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It may attenuate protein kinase C activity by regulating diacylglycerol levels in intracellular signaling cascade and signal transduction. Alternative splicing occurs at this locus and multiple transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2010]
Mouse(104418) diacylglycerol kinase zeta
Rat(81821) diacylglycerol kinase zeta
domestic guinea pig(100735439) diacylglycerol kinase, zeta
naked mole-rat(101696881) diacylglycerol kinase, zeta
sheep(101117698) diacylglycerol kinase, zeta
Domestic Rabbit(100345732) diacylglycerol kinase, zeta
chicken(423197) diacylglycerol kinase, zeta
cow(511887) diacylglycerol kinase, zeta
Horse(100050499) diacylglycerol kinase, zeta
domestic cat(101087348) diacylglycerol kinase, zeta
dog(483635) diacylglycerol kinase, zeta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003646 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105540 Rosetta Predictions human pricing
NM_003646 Rosetta Predictions human pricing
NM_201532 Rosetta Predictions human pricing
NM_201533 Rosetta Predictions human pricing
NM_031143 Rosetta Predictions rat pricing
NM_138306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324291 predicted 1624
2 SASI_Hs02_00324292 predicted 2115
3 SASI_Hs02_00324293 predicted 1602
4 SASI_Hs02_00324294 predicted 2360
5 SASI_Hs02_00324295 predicted 2695
6 SASI_Hs02_00324296 predicted 2129
7 SASI_Hs02_00324297 predicted 2047
8 SASI_Hs02_00324298 predicted 2232
9 SASI_Hs02_00324299 predicted 2620
10 SASI_Hs02_00324300 predicted 2451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198787 predicted 1190
2 SASI_Hs01_00198789 predicted 2646
3 SASI_Hs01_00198791 predicted 1686
4 SASI_Hs01_00198792 predicted 1172
5 SASI_Hs01_00198793 predicted 1932
6 SASI_Hs01_00198794 predicted 2263
7 SASI_Hs02_00336008 predicted 1695
8 SASI_Hs02_00336009 predicted 1608
9 SASI_Hs02_00336010 predicted 1796
10 SASI_Hs02_00336011 predicted 2627
11 SASI_Hs01_00198786 predicted 2425
12 SASI_Hs01_00198788 predicted 2415
13 SASI_Hs01_00198790 predicted 2410
14 SASI_Hs01_00198795 predicted 2406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209747 predicted 1071
2 SASI_Hs01_00209749 predicted 2526
3 SASI_Hs01_00209751 predicted 1559
4 SASI_Hs01_00209752 predicted 1045
5 SASI_Hs01_00209753 predicted 1806
6 SASI_Hs01_00209754 predicted 2140
7 SASI_Hs02_00373009 predicted 1580
8 SASI_Hs02_00373010 predicted 1494
9 SASI_Hs02_00373011 predicted 1670
10 SASI_Hs02_00373012 predicted 2512
11 SASI_Hs01_00209746 predicted 2367
12 SASI_Hs01_00209748 predicted 2365
13 SASI_Hs01_00209750 predicted 2360
14 SASI_Hs01_00209755 predicted 2353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134997 predicted 929
2 SASI_Hs01_00134998 predicted 1411
3 SASI_Hs01_00134999 predicted 899
4 SASI_Hs01_00135001 predicted 1666
5 SASI_Hs01_00135002 predicted 1990
6 SASI_Hs01_00135003 predicted 1427
7 SASI_Hs01_00135004 predicted 1345
8 SASI_Hs01_00135005 predicted 1528
9 SASI_Hs01_00135006 predicted 1918
10 SASI_Hs02_00373013 predicted 1754
11 SASI_Hs01_00135000 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054341 predicted 784
2 SASI_Rn01_00054342 predicted 769
3 SASI_Rn01_00054343 predicted 1525
4 SASI_Rn01_00054344 predicted 1560
5 SASI_Rn01_00054345 predicted 1250
6 SASI_Rn01_00054346 predicted 317
7 SASI_Rn01_00054347 predicted 1732
8 SASI_Rn01_00054349 predicted 2981
9 SASI_Rn01_00054350 predicted 2972
10 SASI_Rn02_00264480 predicted 1107
11 SASI_Rn01_00054348 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108180 predicted 1081
2 SASI_Mm01_00108181 predicted 549
3 SASI_Mm01_00108182 predicted 1534
4 SASI_Mm01_00108183 predicted 617
5 SASI_Mm01_00108184 predicted 2949
6 SASI_Mm01_00108185 predicted 295
7 SASI_Mm01_00108186 predicted 1337
8 SASI_Mm01_00108187 predicted 556
9 SASI_Mm01_00108188 predicted 2956
10 SASI_Mm01_00108189 predicted 1351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003646
VALIDATED
DGKZ MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, zeta
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003646.2-2838s1c1
Sequence:CCGGGCCTCGCTCATGAAGACAGACCTCGAGGTCTGTCTTCATGAGCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003646.2-3396s1c1
Sequence:CCGGCCGGGCTTCCTCCCGGAAACTCTCGAGAGTTTCCGGGAGGAAGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.2-2399s1c1
Sequence:CCGGCCTCAACTATGTGACTGAGATCTCGAGATCTCAGTCACATAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.2-632s1c1
Sequence:CCGGGAAGATAAATTTCCGCTGTAACTCGAGTTACAGCGGAAATTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.2-1624s1c1
Sequence:CCGGGCTTTCGGAATAAGATGTTCTCTCGAGAGAACATCTTATTCCGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003646.2-3040s1c1
Sequence:CCGGCCCACCTCACTGCCACATTCCCTCGAGGGAATGTGGCAGTGAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.2-2804s1c1
Sequence:CCGGGCGCACCATCTGCCACTACATCTCGAGATGTAGTGGCAGATGGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.2-1200s1c1
Sequence:CCGGGCGCTGGAGATGTACCGCAAACTCGAGTTTGCGGTACATCTCCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.x-1279s1c1
Sequence:CCGGAGATGAGCCTGTGTCCAAGATCTCGAGATCTTGGACACAGGCTCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.x-1610s1c1
Sequence:CCGGTGTGATGGAATGGACTTGACTCTCGAGAGTCAAGTCCATTCCATCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.x-2313s1c1
Sequence:CCGGTCGCACAGGATGAGATTTATACTCGAGTATAAATCTCATCCTGTGCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.x-246s1c1
Sequence:CCGGACAGGAAAGCCATCACCAAGTCTCGAGACTTGGTGATGGCTTTCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.x-1603s1c1
Sequence:CCGGAGTGGTGTGTGATGGAATGGACTCGAGTCCATTCCATCACACACCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003646
VALIDATED
DGKZ MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, zeta
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003646.2-2838s1c1
Sequence:CCGGGCCTCGCTCATGAAGACAGACCTCGAGGTCTGTCTTCATGAGCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003646.2-3396s1c1
Sequence:CCGGCCGGGCTTCCTCCCGGAAACTCTCGAGAGTTTCCGGGAGGAAGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.2-2399s1c1
Sequence:CCGGCCTCAACTATGTGACTGAGATCTCGAGATCTCAGTCACATAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.2-632s1c1
Sequence:CCGGGAAGATAAATTTCCGCTGTAACTCGAGTTACAGCGGAAATTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.2-1624s1c1
Sequence:CCGGGCTTTCGGAATAAGATGTTCTCTCGAGAGAACATCTTATTCCGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003646.2-3040s1c1
Sequence:CCGGCCCACCTCACTGCCACATTCCCTCGAGGGAATGTGGCAGTGAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.2-2804s1c1
Sequence:CCGGGCGCACCATCTGCCACTACATCTCGAGATGTAGTGGCAGATGGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.2-1200s1c1
Sequence:CCGGGCGCTGGAGATGTACCGCAAACTCGAGTTTGCGGTACATCTCCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.x-1279s1c1
Sequence:CCGGAGATGAGCCTGTGTCCAAGATCTCGAGATCTTGGACACAGGCTCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.x-1610s1c1
Sequence:CCGGTGTGATGGAATGGACTTGACTCTCGAGAGTCAAGTCCATTCCATCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.x-2313s1c1
Sequence:CCGGTCGCACAGGATGAGATTTATACTCGAGTATAAATCTCATCCTGTGCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.x-246s1c1
Sequence:CCGGACAGGAAAGCCATCACCAAGTCTCGAGACTTGGTGATGGCTTTCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.x-1603s1c1
Sequence:CCGGAGTGGTGTGTGATGGAATGGACTCGAGTCCATTCCATCACACACCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003646
VALIDATED
DGKZ MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, zeta
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003646.2-2838s1c1
Sequence:CCGGGCCTCGCTCATGAAGACAGACCTCGAGGTCTGTCTTCATGAGCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003646.2-3396s1c1
Sequence:CCGGCCGGGCTTCCTCCCGGAAACTCTCGAGAGTTTCCGGGAGGAAGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.2-2399s1c1
Sequence:CCGGCCTCAACTATGTGACTGAGATCTCGAGATCTCAGTCACATAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.2-632s1c1
Sequence:CCGGGAAGATAAATTTCCGCTGTAACTCGAGTTACAGCGGAAATTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.2-1624s1c1
Sequence:CCGGGCTTTCGGAATAAGATGTTCTCTCGAGAGAACATCTTATTCCGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003646.2-3040s1c1
Sequence:CCGGCCCACCTCACTGCCACATTCCCTCGAGGGAATGTGGCAGTGAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.2-2804s1c1
Sequence:CCGGGCGCACCATCTGCCACTACATCTCGAGATGTAGTGGCAGATGGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.2-1200s1c1
Sequence:CCGGGCGCTGGAGATGTACCGCAAACTCGAGTTTGCGGTACATCTCCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.x-1279s1c1
Sequence:CCGGAGATGAGCCTGTGTCCAAGATCTCGAGATCTTGGACACAGGCTCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.x-1610s1c1
Sequence:CCGGTGTGATGGAATGGACTTGACTCTCGAGAGTCAAGTCCATTCCATCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.x-2313s1c1
Sequence:CCGGTCGCACAGGATGAGATTTATACTCGAGTATAAATCTCATCCTGTGCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003646.x-246s1c1
Sequence:CCGGACAGGAAAGCCATCACCAAGTCTCGAGACTTGGTGATGGCTTTCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_003646.x-1603s1c1
Sequence:CCGGAGTGGTGTGTGATGGAATGGACTCGAGTCCATTCCATCACACACCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138306
VALIDATED
DGKZ MISSION shRNA Bacterial Glycerol Stock
diacylglycerol kinase, zeta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138306.1-1699s1c1
Sequence:CCGGCCCAAGATTCAGGACCTGAAACTCGAGTTTCAGGTCCTGAATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138306.1-1570s1c1
Sequence:CCGGGAGAAGTTCAACAGCCGCTTTCTCGAGAAAGCGGCTGTTGAACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138306.1-2124s1c1
Sequence:CCGGCGAGGCTCTACATTATGACAACTCGAGTTGTCATAATGTAGAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138306.1-551s1c1
Sequence:CCGGCCTGTAAGATCGTGGTGCATACTCGAGTATGCACCACGATCTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138306.1-1485s1c1
Sequence:CCGGCCTGGATGTCTTTAACAACTACTCGAGTAGTTGTTAAAGACATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138306.1-1699s21c1
Sequence:CCGGCCCAAGATTCAGGACCTGAAACTCGAGTTTCAGGTCCTGAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138306.1-1485s21c1
Sequence:CCGGCCTGGATGTCTTTAACAACTACTCGAGTAGTTGTTAAAGACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138306.1-551s21c1
Sequence:CCGGCCTGTAAGATCGTGGTGCATACTCGAGTATGCACCACGATCTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138306.1-2124s21c1
Sequence:CCGGCGAGGCTCTACATTATGACAACTCGAGTTGTCATAATGTAGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138306.1-1570s21c1
Sequence:CCGGGAGAAGTTCAACAGCCGCTTTCTCGAGAAAGCGGCTGTTGAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138306
VALIDATED
DGKZ MISSION shRNA shRNA Plasmid DNA
diacylglycerol kinase, zeta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138306.1-1699s1c1
Sequence:CCGGCCCAAGATTCAGGACCTGAAACTCGAGTTTCAGGTCCTGAATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138306.1-1570s1c1
Sequence:CCGGGAGAAGTTCAACAGCCGCTTTCTCGAGAAAGCGGCTGTTGAACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138306.1-2124s1c1
Sequence:CCGGCGAGGCTCTACATTATGACAACTCGAGTTGTCATAATGTAGAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138306.1-551s1c1
Sequence:CCGGCCTGTAAGATCGTGGTGCATACTCGAGTATGCACCACGATCTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138306.1-1485s1c1
Sequence:CCGGCCTGGATGTCTTTAACAACTACTCGAGTAGTTGTTAAAGACATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138306.1-1699s21c1
Sequence:CCGGCCCAAGATTCAGGACCTGAAACTCGAGTTTCAGGTCCTGAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138306.1-1485s21c1
Sequence:CCGGCCTGGATGTCTTTAACAACTACTCGAGTAGTTGTTAAAGACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138306.1-551s21c1
Sequence:CCGGCCTGTAAGATCGTGGTGCATACTCGAGTATGCACCACGATCTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138306.1-2124s21c1
Sequence:CCGGCGAGGCTCTACATTATGACAACTCGAGTTGTCATAATGTAGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138306.1-1570s21c1
Sequence:CCGGGAGAAGTTCAACAGCCGCTTTCTCGAGAAAGCGGCTGTTGAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138306
VALIDATED
DGKZ MISSION shRNA Lentiviral Transduction Particles
diacylglycerol kinase, zeta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138306.1-1699s1c1
Sequence:CCGGCCCAAGATTCAGGACCTGAAACTCGAGTTTCAGGTCCTGAATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138306.1-1570s1c1
Sequence:CCGGGAGAAGTTCAACAGCCGCTTTCTCGAGAAAGCGGCTGTTGAACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138306.1-2124s1c1
Sequence:CCGGCGAGGCTCTACATTATGACAACTCGAGTTGTCATAATGTAGAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138306.1-551s1c1
Sequence:CCGGCCTGTAAGATCGTGGTGCATACTCGAGTATGCACCACGATCTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138306.1-1485s1c1
Sequence:CCGGCCTGGATGTCTTTAACAACTACTCGAGTAGTTGTTAAAGACATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138306.1-1699s21c1
Sequence:CCGGCCCAAGATTCAGGACCTGAAACTCGAGTTTCAGGTCCTGAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138306.1-1485s21c1
Sequence:CCGGCCTGGATGTCTTTAACAACTACTCGAGTAGTTGTTAAAGACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138306.1-551s21c1
Sequence:CCGGCCTGTAAGATCGTGGTGCATACTCGAGTATGCACCACGATCTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138306.1-2124s21c1
Sequence:CCGGCGAGGCTCTACATTATGACAACTCGAGTTGTCATAATGTAGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138306.1-1570s21c1
Sequence:CCGGGAGAAGTTCAACAGCCGCTTTCTCGAGAAAGCGGCTGTTGAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks