EMAIL THIS PAGE TO A FRIEND

DGUOK

deoxyguanosine kinase

137 Gene Product Result for
Synonyms: MTDPS3 dGK
UniProtKB ID: Q16854, P78532, Q16759, Q4ZG09, Q96BC1
Gene ID:
Human(1716) Summary: In mammalian cells, the phosphorylation of purine deoxyribonucleosides is mediated predominantly by two deoxyribonucleoside kinases, cytosolic deoxycytidine kinase and mitochondrial deoxyguanosine kinase. The protein encoded by this gene is responsible for phosphorylation of purine deoxyribonucleosides in the mitochondrial matrix. In addition, this protein phosphorylates several purine deoxyribonucleoside analogs used in the treatment of lymphoproliferative disorders, and this phosphorylation is critical for the effectiveness of the analogs. Alternative splice variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(27369) deoxyguanosine kinase
Rat(297389) deoxyguanosine kinase
Zebrafish(100005067) deoxyguanosine kinase
dog(475791) deoxyguanosine kinase
cow(509834) deoxyguanosine kinase
domestic cat(101083164) deoxyguanosine kinase
chicken(770922) deoxyguanosine kinase
sheep(101114690) deoxyguanosine kinase
naked mole-rat(101709356) deoxyguanosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080916 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001929 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080916 Rosetta Predictions human pricing
NM_080918 Rosetta Predictions human pricing
NM_001106602 Rosetta Predictions rat pricing
NM_013764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153385 predicted 225
2 SASI_Hs01_00153386 predicted 233
3 SASI_Hs01_00153387 predicted 232
4 SASI_Hs01_00153388 predicted 235
5 SASI_Hs01_00153389 predicted 265
6 SASI_Hs01_00153390 predicted 207
7 SASI_Hs01_00153391 predicted 279
8 SASI_Hs01_00153392 predicted 279
9 SASI_Hs01_00153393 predicted 238
10 SASI_Hs01_00153394 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134240 predicted 224
2 SASI_Hs01_00134241 predicted 233
3 SASI_Hs01_00134242 predicted 234
4 SASI_Hs01_00134243 predicted 241
5 SASI_Hs01_00134244 predicted 268
6 SASI_Hs01_00134245 predicted 201
7 SASI_Hs01_00134246 predicted 281
8 SASI_Hs01_00134247 predicted 278
9 SASI_Hs01_00134248 predicted 236
10 SASI_Hs01_00134249 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220568 predicted 194
2 SASI_Rn02_00220569 predicted 688
3 SASI_Rn02_00220570 predicted 497
4 SASI_Rn02_00220571 predicted 685
5 SASI_Rn02_00220572 predicted 762
6 SASI_Rn02_00220573 predicted 467
7 SASI_Rn02_00220574 predicted 725
8 SASI_Rn02_00220575 predicted 722
9 SASI_Rn02_00220576 predicted 249
10 SASI_Rn02_00220577 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179801 predicted 482
2 SASI_Mm01_00179802 predicted 323
3 SASI_Mm02_00322713 predicted 272
4 SASI_Mm01_00179803 predicted 488
5 SASI_Mm01_00179804 predicted 606
6 SASI_Mm01_00179806 predicted 445
7 SASI_Mm01_00179807 predicted 282
8 SASI_Mm01_00179808 predicted 259
9 SASI_Mm01_00179809 predicted 446
10 SASI_Mm01_00179810 predicted 207
11 SASI_Mm01_00179805 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080916
VALIDATED
DGUOK MISSION shRNA Bacterial Glycerol Stock
deoxyguanosine kinase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_080916.1-758s21c1
Sequence:GTACCGGCAACACGAAGCCTGGCTTATTCTCGAGAATAAGCCAGGCTTCGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080916.1-623s1c1
Sequence:CCGGTTTGCCAGCCGGATCACATTACTCGAGTAATGTGATCCGGCTGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080916.1-573s1c1
Sequence:CCGGACATCGAGTGGCATATCTATCCTCGAGGATAGATATGCCACTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_080916.1-955s21c1
Sequence:CCGGCCTGACTTTCTGAAGCTAGAACTCGAGTTCTAGCTTCAGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_080916.1-394s21c1
Sequence:CCGGAGCACGATGGTCCTACACATTCTCGAGAATGTGTAGGACCATCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080916.1-206s21c1
Sequence:CCGGCTCTCCATCGAAGGCAACATTCTCGAGAATGTTGCCTTCGATGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080916.1-568s21c1
Sequence:GTACCGGCAGTGACATCGAGTGGCATATCTCGAGATATGCCACTCGATGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080916.1-878s1c1
Sequence:CCGGGACCTCATGAGAGAGGTAAACCTCGAGGTTTACCTCTCTCATGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080916.1-240s1c1
Sequence:CCGGCCACGTTTGTGAAGTTACTCACTCGAGTGAGTAACTTCACAAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080916.1-920s1c1
Sequence:CCGGCCAATACCATGAAGTTCAGGCCTCGAGGCCTGAACTTCATGGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080916
VALIDATED
DGUOK MISSION shRNA shRNA Plasmid DNA
deoxyguanosine kinase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_080916.1-758s21c1
Sequence:GTACCGGCAACACGAAGCCTGGCTTATTCTCGAGAATAAGCCAGGCTTCGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080916.1-623s1c1
Sequence:CCGGTTTGCCAGCCGGATCACATTACTCGAGTAATGTGATCCGGCTGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080916.1-573s1c1
Sequence:CCGGACATCGAGTGGCATATCTATCCTCGAGGATAGATATGCCACTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_080916.1-955s21c1
Sequence:CCGGCCTGACTTTCTGAAGCTAGAACTCGAGTTCTAGCTTCAGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_080916.1-394s21c1
Sequence:CCGGAGCACGATGGTCCTACACATTCTCGAGAATGTGTAGGACCATCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080916.1-206s21c1
Sequence:CCGGCTCTCCATCGAAGGCAACATTCTCGAGAATGTTGCCTTCGATGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080916.1-568s21c1
Sequence:GTACCGGCAGTGACATCGAGTGGCATATCTCGAGATATGCCACTCGATGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080916.1-878s1c1
Sequence:CCGGGACCTCATGAGAGAGGTAAACCTCGAGGTTTACCTCTCTCATGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080916.1-240s1c1
Sequence:CCGGCCACGTTTGTGAAGTTACTCACTCGAGTGAGTAACTTCACAAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080916.1-920s1c1
Sequence:CCGGCCAATACCATGAAGTTCAGGCCTCGAGGCCTGAACTTCATGGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080916
VALIDATED
DGUOK MISSION shRNA Lentiviral Transduction Particles
deoxyguanosine kinase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_080916.1-758s21c1
Sequence:GTACCGGCAACACGAAGCCTGGCTTATTCTCGAGAATAAGCCAGGCTTCGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080916.1-623s1c1
Sequence:CCGGTTTGCCAGCCGGATCACATTACTCGAGTAATGTGATCCGGCTGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080916.1-573s1c1
Sequence:CCGGACATCGAGTGGCATATCTATCCTCGAGGATAGATATGCCACTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_080916.1-955s21c1
Sequence:CCGGCCTGACTTTCTGAAGCTAGAACTCGAGTTCTAGCTTCAGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_080916.1-394s21c1
Sequence:CCGGAGCACGATGGTCCTACACATTCTCGAGAATGTGTAGGACCATCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080916.1-206s21c1
Sequence:CCGGCTCTCCATCGAAGGCAACATTCTCGAGAATGTTGCCTTCGATGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080916.1-568s21c1
Sequence:GTACCGGCAGTGACATCGAGTGGCATATCTCGAGATATGCCACTCGATGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080916.1-878s1c1
Sequence:CCGGGACCTCATGAGAGAGGTAAACCTCGAGGTTTACCTCTCTCATGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080916.1-240s1c1
Sequence:CCGGCCACGTTTGTGAAGTTACTCACTCGAGTGAGTAACTTCACAAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080916.1-920s1c1
Sequence:CCGGCCAATACCATGAAGTTCAGGCCTCGAGGCCTGAACTTCATGGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013764
VALIDATED
DGUOK MISSION shRNA Bacterial Glycerol Stock
deoxyguanosine kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-265s21c1
Sequence:CCGGGCACTTCCAAACGTCTTGGAACTCGAGTTCCAAGACGTTTGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-680s21c1
Sequence:CCGGGCACGAAGACTGGTTTATTAACTCGAGTTAATAAACCAGTCTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-815s21c1
Sequence:CCGGGAACACCTTTATGAGGAACTTCTCGAGAAGTTCCTCATAAAGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-568s21c1
Sequence:CCGGGCTTCATCTATCTCCAGGCTTCTCGAGAAGCCTGGAGATAGATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-276s21c1
Sequence:CCGGCGTCTTGGAAACTTGCTAGAACTCGAGTTCTAGCAAGTTTCCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013764.1-276s1c1
Sequence:CCGGCGTCTTGGAAACTTGCTAGAACTCGAGTTCTAGCAAGTTTCCAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013764.1-815s1c1
Sequence:CCGGGAACACCTTTATGAGGAACTTCTCGAGAAGTTCCTCATAAAGGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013764.1-265s1c1
Sequence:CCGGGCACTTCCAAACGTCTTGGAACTCGAGTTCCAAGACGTTTGGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013764.1-680s1c1
Sequence:CCGGGCACGAAGACTGGTTTATTAACTCGAGTTAATAAACCAGTCTTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013764.1-568s1c1
Sequence:CCGGGCTTCATCTATCTCCAGGCTTCTCGAGAAGCCTGGAGATAGATGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013764
VALIDATED
DGUOK MISSION shRNA shRNA Plasmid DNA
deoxyguanosine kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-265s21c1
Sequence:CCGGGCACTTCCAAACGTCTTGGAACTCGAGTTCCAAGACGTTTGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-680s21c1
Sequence:CCGGGCACGAAGACTGGTTTATTAACTCGAGTTAATAAACCAGTCTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-815s21c1
Sequence:CCGGGAACACCTTTATGAGGAACTTCTCGAGAAGTTCCTCATAAAGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-568s21c1
Sequence:CCGGGCTTCATCTATCTCCAGGCTTCTCGAGAAGCCTGGAGATAGATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-276s21c1
Sequence:CCGGCGTCTTGGAAACTTGCTAGAACTCGAGTTCTAGCAAGTTTCCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013764.1-276s1c1
Sequence:CCGGCGTCTTGGAAACTTGCTAGAACTCGAGTTCTAGCAAGTTTCCAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013764.1-815s1c1
Sequence:CCGGGAACACCTTTATGAGGAACTTCTCGAGAAGTTCCTCATAAAGGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013764.1-265s1c1
Sequence:CCGGGCACTTCCAAACGTCTTGGAACTCGAGTTCCAAGACGTTTGGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013764.1-680s1c1
Sequence:CCGGGCACGAAGACTGGTTTATTAACTCGAGTTAATAAACCAGTCTTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013764.1-568s1c1
Sequence:CCGGGCTTCATCTATCTCCAGGCTTCTCGAGAAGCCTGGAGATAGATGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013764
VALIDATED
DGUOK MISSION shRNA Lentiviral Transduction Particles
deoxyguanosine kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-265s21c1
Sequence:CCGGGCACTTCCAAACGTCTTGGAACTCGAGTTCCAAGACGTTTGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-680s21c1
Sequence:CCGGGCACGAAGACTGGTTTATTAACTCGAGTTAATAAACCAGTCTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-815s21c1
Sequence:CCGGGAACACCTTTATGAGGAACTTCTCGAGAAGTTCCTCATAAAGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-568s21c1
Sequence:CCGGGCTTCATCTATCTCCAGGCTTCTCGAGAAGCCTGGAGATAGATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013764.1-276s21c1
Sequence:CCGGCGTCTTGGAAACTTGCTAGAACTCGAGTTCTAGCAAGTTTCCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013764.1-276s1c1
Sequence:CCGGCGTCTTGGAAACTTGCTAGAACTCGAGTTCTAGCAAGTTTCCAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013764.1-815s1c1
Sequence:CCGGGAACACCTTTATGAGGAACTTCTCGAGAAGTTCCTCATAAAGGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013764.1-265s1c1
Sequence:CCGGGCACTTCCAAACGTCTTGGAACTCGAGTTCCAAGACGTTTGGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013764.1-680s1c1
Sequence:CCGGGCACGAAGACTGGTTTATTAACTCGAGTTAATAAACCAGTCTTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013764.1-568s1c1
Sequence:CCGGGCTTCATCTATCTCCAGGCTTCTCGAGAAGCCTGGAGATAGATGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001929
VALIDATED
DGUOK MISSION shRNA Bacterial Glycerol Stock
deoxyguanosine kinase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-578s1c1
Sequence:CCGGCCTGACTTTCTGAAGCTAGAACTCGAGTTCTAGCTTCAGAAAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-281s1c1
Sequence:CCGGAGCACGATGGTCCTACACATTCTCGAGAATGTGTAGGACCATCGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-206s1c1
Sequence:CCGGCTCTCCATCGAAGGCAACATTCTCGAGAATGTTGCCTTCGATGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-291s1c1
Sequence:CCGGTCCTACACATTCCAGACATTTCTCGAGAAATGTCTGGAATGTGTAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-233s1c1
Sequence:CCGGCACTGCCCAAAGTCTTGGAAACTCGAGTTTCCAAGACTTTGGGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001929
VALIDATED
DGUOK MISSION shRNA shRNA Plasmid DNA
deoxyguanosine kinase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-578s1c1
Sequence:CCGGCCTGACTTTCTGAAGCTAGAACTCGAGTTCTAGCTTCAGAAAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-281s1c1
Sequence:CCGGAGCACGATGGTCCTACACATTCTCGAGAATGTGTAGGACCATCGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-206s1c1
Sequence:CCGGCTCTCCATCGAAGGCAACATTCTCGAGAATGTTGCCTTCGATGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-291s1c1
Sequence:CCGGTCCTACACATTCCAGACATTTCTCGAGAAATGTCTGGAATGTGTAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-233s1c1
Sequence:CCGGCACTGCCCAAAGTCTTGGAAACTCGAGTTTCCAAGACTTTGGGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001929
VALIDATED
DGUOK MISSION shRNA Lentiviral Transduction Particles
deoxyguanosine kinase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-578s1c1
Sequence:CCGGCCTGACTTTCTGAAGCTAGAACTCGAGTTCTAGCTTCAGAAAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-281s1c1
Sequence:CCGGAGCACGATGGTCCTACACATTCTCGAGAATGTGTAGGACCATCGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-206s1c1
Sequence:CCGGCTCTCCATCGAAGGCAACATTCTCGAGAATGTTGCCTTCGATGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-291s1c1
Sequence:CCGGTCCTACACATTCCAGACATTTCTCGAGAAATGTCTGGAATGTGTAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001929.2-233s1c1
Sequence:CCGGCACTGCCCAAAGTCTTGGAAACTCGAGTTTCCAAGACTTTGGGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks