EMAIL THIS PAGE TO A FRIEND

DHCR24

24-dehydrocholesterol reductase

Synonyms: DCE Nbla03646 SELADIN1 seladin-1
UniProtKB ID: Q15392, D3DQ51, Q9HBA8
Gene ID:
Human(1718) Summary: This gene encodes a flavin adenine dinucleotide (FAD)-dependent oxidoreductase which catalyzes the reduction of the delta-24 double bond of sterol intermediates during cholesterol biosynthesis. The protein contains a leader sequence that directs it to the endoplasmic reticulum membrane. Missense mutations in this gene have been associated with desmosterolosis. Also, reduced expression of the gene occurs in the temporal cortex of Alzheimer disease patients and overexpression has been observed in adrenal gland cancer cells. [provided by RefSeq, Jul 2008]
Mouse(74754) 24-dehydrocholesterol reductase
Rat(298298) 24-dehydrocholesterol reductase
Zebrafish(494102) 24-dehydrocholesterol reductase
dog(489573) 24-dehydrocholesterol reductase
domestic cat(101098730) 24-dehydrocholesterol reductase
cow(533726) 24-dehydrocholesterol reductase
Horse(100034055) 24-dehydrocholesterol reductase
chicken(424661) 24-dehydrocholesterol reductase
sheep(101123162) 24-dehydrocholesterol reductase
domestic guinea pig(100714000) 24-dehydrocholesterol reductase
naked mole-rat(101703975) 24-dehydrocholesterol reductase
Gene Class: Dehydrogenase
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014762 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014762 Rosetta Predictions human pricing
NM_001080148 Rosetta Predictions rat pricing
NM_053272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054135 predicted 996
2 SASI_Hs01_00054136 predicted 380
3 SASI_Hs01_00054138 predicted 1238
4 SASI_Hs01_00054139 predicted 1077
5 SASI_Hs01_00054140 predicted 421
6 SASI_Hs01_00054141 predicted 214
7 SASI_Hs02_00346246 predicted 1187
8 SASI_Hs01_00054142 predicted 556
9 SASI_Hs02_00346247 predicted 1049
10 SASI_Hs01_00054143 predicted 1418
11 SASI_Hs01_00054137 predicted 1393
12 SASI_Hs01_00054144 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208409 predicted 512
2 SASI_Rn02_00208410 predicted 514
3 SASI_Rn02_00208411 predicted 1111
4 SASI_Rn02_00208412 predicted 420
5 SASI_Rn02_00208413 predicted 402
6 SASI_Rn02_00208414 predicted 1155
7 SASI_Rn02_00208415 predicted 447
8 SASI_Rn02_00208416 predicted 1275
9 SASI_Rn02_00208417 predicted 663
10 SASI_Rn02_00208418 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183440 predicted 641
2 SASI_Mm01_00183443 predicted 993
3 SASI_Mm02_00337937 predicted 813
4 SASI_Mm02_00337938 predicted 1044
5 SASI_Mm02_00337939 predicted 1046
6 SASI_Mm01_00183441 predicted 1108
7 SASI_Mm02_00337940 predicted 808
8 SASI_Mm02_00337941 predicted 1199
9 SASI_Mm02_00337942 predicted 1115
10 SASI_Mm01_00183444 predicted 1295
11 SASI_Mm01_00183442 predicted 1048
12 SASI_Mm01_00183445 predicted 896
13 SASI_Mm01_00183446 predicted 995
14 SASI_Mm01_00183447 predicted 513
15 SASI_Mm01_00183448 predicted 260
16 SASI_Mm01_00183449 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014762
VALIDATED
DHCR24 MISSION shRNA Bacterial Glycerol Stock
24-dehydrocholesterol reductase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-222s1c1
Sequence:CCGGGCTCTCGCTTATCTTCGATATCTCGAGATATCGAAGATAAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-648s1c1
Sequence:CCGGCCAACACATCTGCACTGCTTACTCGAGTAAGCAGTGCAGATGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-1390s1c1
Sequence:CCGGGCAGAGCTCTACATCGACATTCTCGAGAATGTCGATGTAGAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-618s1c1
Sequence:CCGGCGAGTCATCATCCCACAAGTACTCGAGTACTTGTGGGATGATGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-1426s1c1
Sequence:CCGGCCGCGTGTGAAACACTTTGAACTCGAGTTCAAAGTGTTTCACACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014762.3-1456s21c1
Sequence:CCGGCCGCGTGTGAAACACTTTGAACTCGAGTTCAAAGTGTTTCACACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014762.3-1420s21c1
Sequence:CCGGGCAGAGCTCTACATCGACATTCTCGAGAATGTCGATGTAGAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014762.3-678s21c1
Sequence:CCGGCCAACACATCTGCACTGCTTACTCGAGTAAGCAGTGCAGATGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014762.3-252s21c1
Sequence:CCGGGCTCTCGCTTATCTTCGATATCTCGAGATATCGAAGATAAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014762
VALIDATED
DHCR24 MISSION shRNA shRNA Plasmid DNA
24-dehydrocholesterol reductase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-222s1c1
Sequence:CCGGGCTCTCGCTTATCTTCGATATCTCGAGATATCGAAGATAAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-648s1c1
Sequence:CCGGCCAACACATCTGCACTGCTTACTCGAGTAAGCAGTGCAGATGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-1390s1c1
Sequence:CCGGGCAGAGCTCTACATCGACATTCTCGAGAATGTCGATGTAGAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-618s1c1
Sequence:CCGGCGAGTCATCATCCCACAAGTACTCGAGTACTTGTGGGATGATGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-1426s1c1
Sequence:CCGGCCGCGTGTGAAACACTTTGAACTCGAGTTCAAAGTGTTTCACACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014762.3-1456s21c1
Sequence:CCGGCCGCGTGTGAAACACTTTGAACTCGAGTTCAAAGTGTTTCACACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014762.3-1420s21c1
Sequence:CCGGGCAGAGCTCTACATCGACATTCTCGAGAATGTCGATGTAGAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014762.3-678s21c1
Sequence:CCGGCCAACACATCTGCACTGCTTACTCGAGTAAGCAGTGCAGATGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014762.3-252s21c1
Sequence:CCGGGCTCTCGCTTATCTTCGATATCTCGAGATATCGAAGATAAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014762
VALIDATED
DHCR24 MISSION shRNA Lentiviral Transduction Particles
24-dehydrocholesterol reductase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-222s1c1
Sequence:CCGGGCTCTCGCTTATCTTCGATATCTCGAGATATCGAAGATAAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-648s1c1
Sequence:CCGGCCAACACATCTGCACTGCTTACTCGAGTAAGCAGTGCAGATGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-1390s1c1
Sequence:CCGGGCAGAGCTCTACATCGACATTCTCGAGAATGTCGATGTAGAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-618s1c1
Sequence:CCGGCGAGTCATCATCCCACAAGTACTCGAGTACTTGTGGGATGATGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014762.1-1426s1c1
Sequence:CCGGCCGCGTGTGAAACACTTTGAACTCGAGTTCAAAGTGTTTCACACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014762.3-1456s21c1
Sequence:CCGGCCGCGTGTGAAACACTTTGAACTCGAGTTCAAAGTGTTTCACACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014762.3-1420s21c1
Sequence:CCGGGCAGAGCTCTACATCGACATTCTCGAGAATGTCGATGTAGAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014762.3-678s21c1
Sequence:CCGGCCAACACATCTGCACTGCTTACTCGAGTAAGCAGTGCAGATGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014762.3-252s21c1
Sequence:CCGGGCTCTCGCTTATCTTCGATATCTCGAGATATCGAAGATAAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053272
DHCR24 MISSION shRNA Bacterial Glycerol Stock
24-dehydrocholesterol reductase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-1444s1c1
Sequence:CCGGGCTATATGAACCGCGAGGAATCTCGAGATTCCTCGCGGTTCATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-899s1c1
Sequence:CCGGGCTGAATAGCATTGGCAGTTACTCGAGTAACTGCCAATGCTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-140s1c1
Sequence:CCGGGCTCTCGCTCATCTTCGATATCTCGAGATATCGAAGATGAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-1415s1c1
Sequence:CCGGGCACGGGTTCCAAATGTTATACTCGAGTATAACATTTGGAACCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-390s1c1
Sequence:CCGGGACACCAAGAAACAGATTGTTCTCGAGAACAATCTGTTTCTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-252s21c1
Sequence:CCGGGCTCTCGCTCATCTTCGATATCTCGAGATATCGAAGATGAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-502s21c1
Sequence:CCGGGACACCAAGAAACAGATTGTTCTCGAGAACAATCTGTTTCTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-1005s21c1
Sequence:CCGGGCTGAATAGCATTGGCAGTTACTCGAGTAACTGCCAATGCTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-1550s21c1
Sequence:CCGGGCTATATGAACCGCGAGGAATCTCGAGATTCCTCGCGGTTCATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-1521s21c1
Sequence:CCGGGCACGGGTTCCAAATGTTATACTCGAGTATAACATTTGGAACCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053272
DHCR24 MISSION shRNA shRNA Plasmid DNA
24-dehydrocholesterol reductase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-1444s1c1
Sequence:CCGGGCTATATGAACCGCGAGGAATCTCGAGATTCCTCGCGGTTCATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-899s1c1
Sequence:CCGGGCTGAATAGCATTGGCAGTTACTCGAGTAACTGCCAATGCTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-140s1c1
Sequence:CCGGGCTCTCGCTCATCTTCGATATCTCGAGATATCGAAGATGAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-1415s1c1
Sequence:CCGGGCACGGGTTCCAAATGTTATACTCGAGTATAACATTTGGAACCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-390s1c1
Sequence:CCGGGACACCAAGAAACAGATTGTTCTCGAGAACAATCTGTTTCTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-252s21c1
Sequence:CCGGGCTCTCGCTCATCTTCGATATCTCGAGATATCGAAGATGAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-502s21c1
Sequence:CCGGGACACCAAGAAACAGATTGTTCTCGAGAACAATCTGTTTCTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-1005s21c1
Sequence:CCGGGCTGAATAGCATTGGCAGTTACTCGAGTAACTGCCAATGCTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-1550s21c1
Sequence:CCGGGCTATATGAACCGCGAGGAATCTCGAGATTCCTCGCGGTTCATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-1521s21c1
Sequence:CCGGGCACGGGTTCCAAATGTTATACTCGAGTATAACATTTGGAACCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053272
DHCR24 MISSION shRNA Lentiviral Transduction Particles
24-dehydrocholesterol reductase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-1444s1c1
Sequence:CCGGGCTATATGAACCGCGAGGAATCTCGAGATTCCTCGCGGTTCATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-899s1c1
Sequence:CCGGGCTGAATAGCATTGGCAGTTACTCGAGTAACTGCCAATGCTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-140s1c1
Sequence:CCGGGCTCTCGCTCATCTTCGATATCTCGAGATATCGAAGATGAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-1415s1c1
Sequence:CCGGGCACGGGTTCCAAATGTTATACTCGAGTATAACATTTGGAACCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053272.1-390s1c1
Sequence:CCGGGACACCAAGAAACAGATTGTTCTCGAGAACAATCTGTTTCTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-252s21c1
Sequence:CCGGGCTCTCGCTCATCTTCGATATCTCGAGATATCGAAGATGAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-502s21c1
Sequence:CCGGGACACCAAGAAACAGATTGTTCTCGAGAACAATCTGTTTCTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-1005s21c1
Sequence:CCGGGCTGAATAGCATTGGCAGTTACTCGAGTAACTGCCAATGCTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-1550s21c1
Sequence:CCGGGCTATATGAACCGCGAGGAATCTCGAGATTCCTCGCGGTTCATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053272.2-1521s21c1
Sequence:CCGGGCACGGGTTCCAAATGTTATACTCGAGTATAACATTTGGAACCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks