EMAIL THIS PAGE TO A FRIEND

DHCR7

7-dehydrocholesterol reductase

60 Gene Product Result for
Synonyms: SLOS
UniProtKB ID: Q9UBM7, B2R6Z2, O60492, O60717
Gene ID:
Human(1717) Summary: This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
Mouse(13360) 7-dehydrocholesterol reductase
Rat(64191) 7-dehydrocholesterol reductase
naked mole-rat(101703035) 7-dehydrocholesterol reductase
domestic guinea pig(100732833) 7-dehydrocholesterol reductase
sheep(101118320) 7-dehydrocholesterol reductase
Zebrafish(378446) 7-dehydrocholesterol reductase
cow(514745) 7-dehydrocholesterol reductase
Horse(100061433) 7-dehydrocholesterol reductase
domestic cat(101089143) 7-dehydrocholesterol reductase
dog(483675) 7-dehydrocholesterol reductase
chicken(422982) 7-dehydrocholesterol reductase
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001360 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059701 MISSION® esiRNA esiRNA human DHCR7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001360 Rosetta Predictions human pricing
NM_022389 Rosetta Predictions rat pricing
NM_007856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031708 predicted 566
2 SASI_Hs01_00031709 predicted 1557
3 SASI_Hs01_00031710 predicted 498
4 SASI_Hs01_00031711 predicted 1204
5 SASI_Hs01_00031712 predicted 1109
6 SASI_Hs01_00031713 predicted 2124
7 SASI_Hs01_00031714 predicted 547
8 SASI_Hs01_00031715 predicted 2024
9 SASI_Hs01_00031716 predicted 1237
10 SASI_Hs02_00331698 predicted 766
11 SASI_Hs01_00031717 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052370 predicted 610
2 SASI_Rn01_00052371 predicted 784
3 SASI_Rn01_00052372 predicted 791
4 SASI_Rn01_00052373 predicted 828
5 SASI_Rn02_00263155 predicted 1211
6 SASI_Rn01_00052374 predicted 479
7 SASI_Rn01_00052375 predicted 720
8 SASI_Rn01_00052376 predicted 1158
9 SASI_Rn02_00263156 predicted 1718
10 SASI_Rn01_00052377 predicted 1469
11 SASI_Rn01_00052369 predicted 1132
12 SASI_Rn01_00052378 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156063 predicted 635
2 SASI_Mm01_00156065 predicted 1182
3 SASI_Mm02_00312627 predicted 1127
4 SASI_Mm01_00156066 predicted 1266
5 SASI_Mm01_00156067 predicted 639
6 SASI_Mm01_00156068 predicted 1997
7 SASI_Mm01_00156069 predicted 837
8 SASI_Mm01_00156070 predicted 784
9 SASI_Mm01_00156071 predicted 848
10 SASI_Mm01_00156072 predicted 1942
11 SASI_Mm01_00156064 predicted 2018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007856
VALIDATED
DHCR7 MISSION shRNA Bacterial Glycerol Stock
7-dehydrocholesterol reductase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007856.2-1182s21c1
Sequence:CCGGCGGGAAGTGGTTTGACTTCAACTCGAGTTGAAGTCAAACCACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007856.2-1850s21c1
Sequence:CCGGCCAACAAGTATGGCCGTGATTCTCGAGAATCACGGCCATACTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007856.2-849s21c1
Sequence:CCGGCCACAGATTTCTGCCAGGTTACTCGAGTAACCTGGCAGAAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007856.2-1527s21c1
Sequence:CCGGCCTCGTGGGTTACTATATCTTCTCGAGAAGATATAGTAACCCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007856.2-1527s1c1
Sequence:CCGGCCTCGTGGGTTACTATATCTTCTCGAGAAGATATAGTAACCCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007856.2-849s1c1
Sequence:CCGGCCACAGATTTCTGCCAGGTTACTCGAGTAACCTGGCAGAAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007856.2-1182s1c1
Sequence:CCGGCGGGAAGTGGTTTGACTTCAACTCGAGTTGAAGTCAAACCACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007856.2-642s1c1
Sequence:CCGGCGCTCCATTCATTGTGTACTACTCGAGTAGTACACAATGAATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007856.2-1850s1c1
Sequence:CCGGCCAACAAGTATGGCCGTGATTCTCGAGAATCACGGCCATACTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007856
VALIDATED
DHCR7 MISSION shRNA shRNA Plasmid DNA
7-dehydrocholesterol reductase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007856.2-1182s21c1
Sequence:CCGGCGGGAAGTGGTTTGACTTCAACTCGAGTTGAAGTCAAACCACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007856.2-1850s21c1
Sequence:CCGGCCAACAAGTATGGCCGTGATTCTCGAGAATCACGGCCATACTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007856.2-849s21c1
Sequence:CCGGCCACAGATTTCTGCCAGGTTACTCGAGTAACCTGGCAGAAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007856.2-1527s21c1
Sequence:CCGGCCTCGTGGGTTACTATATCTTCTCGAGAAGATATAGTAACCCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007856.2-1527s1c1
Sequence:CCGGCCTCGTGGGTTACTATATCTTCTCGAGAAGATATAGTAACCCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007856.2-849s1c1
Sequence:CCGGCCACAGATTTCTGCCAGGTTACTCGAGTAACCTGGCAGAAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007856.2-1182s1c1
Sequence:CCGGCGGGAAGTGGTTTGACTTCAACTCGAGTTGAAGTCAAACCACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007856.2-642s1c1
Sequence:CCGGCGCTCCATTCATTGTGTACTACTCGAGTAGTACACAATGAATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007856.2-1850s1c1
Sequence:CCGGCCAACAAGTATGGCCGTGATTCTCGAGAATCACGGCCATACTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007856
VALIDATED
DHCR7 MISSION shRNA Lentiviral Transduction Particles
7-dehydrocholesterol reductase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007856.2-1182s21c1
Sequence:CCGGCGGGAAGTGGTTTGACTTCAACTCGAGTTGAAGTCAAACCACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007856.2-1850s21c1
Sequence:CCGGCCAACAAGTATGGCCGTGATTCTCGAGAATCACGGCCATACTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007856.2-849s21c1
Sequence:CCGGCCACAGATTTCTGCCAGGTTACTCGAGTAACCTGGCAGAAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007856.2-1527s21c1
Sequence:CCGGCCTCGTGGGTTACTATATCTTCTCGAGAAGATATAGTAACCCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007856.2-1527s1c1
Sequence:CCGGCCTCGTGGGTTACTATATCTTCTCGAGAAGATATAGTAACCCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007856.2-849s1c1
Sequence:CCGGCCACAGATTTCTGCCAGGTTACTCGAGTAACCTGGCAGAAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007856.2-1182s1c1
Sequence:CCGGCGGGAAGTGGTTTGACTTCAACTCGAGTTGAAGTCAAACCACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007856.2-642s1c1
Sequence:CCGGCGCTCCATTCATTGTGTACTACTCGAGTAGTACACAATGAATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007856.2-1850s1c1
Sequence:CCGGCCAACAAGTATGGCCGTGATTCTCGAGAATCACGGCCATACTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001360
VALIDATED
DHCR7 MISSION shRNA Bacterial Glycerol Stock
7-dehydrocholesterol reductase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001360.2-974s21c1
Sequence:GTACCGGACTTCAAGCTGTTCTTCAATGCTCGAGCATTGAAGAACAGCTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001360.2-530s21c1
Sequence:CCGGGGGCCAAGACTCCACCTATAACTCGAGTTATAGGTGGAGTCTTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001360.2-1913s21c1
Sequence:CCGGATTGCCAGCACAGACGGATTTCTCGAGAAATCCGTCTGTGCTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001360.2-929s21c1
Sequence:CCGGACATGATGGGCATCGAGTTTACTCGAGTAAACTCGATGCCCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001360.1-536s1c1
Sequence:CCGGCCCTGACTTCTGCCATAAGTTCTCGAGAACTTATGGCAGAAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001360.1-1034s1c1
Sequence:CCGGCGTGATTGACTTCTTCTGGAACTCGAGTTCCAGAAGAAGTCAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001360.1-818s1c1
Sequence:CCGGCTGCAAATTCACAGGCAATTTCTCGAGAAATTGCCTGTGAATTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001360.1-701s1c1
Sequence:CCGGGCCCACCATCATCTTCGACAACTCGAGTTGTCGAAGATGATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_001360.1-1136s1c1
Sequence:CCGGGCCTTATCTTTACACGCTGCACTCGAGTGCAGCGTGTAAAGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001360
VALIDATED
DHCR7 MISSION shRNA shRNA Plasmid DNA
7-dehydrocholesterol reductase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001360.2-974s21c1
Sequence:GTACCGGACTTCAAGCTGTTCTTCAATGCTCGAGCATTGAAGAACAGCTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001360.2-530s21c1
Sequence:CCGGGGGCCAAGACTCCACCTATAACTCGAGTTATAGGTGGAGTCTTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001360.2-1913s21c1
Sequence:CCGGATTGCCAGCACAGACGGATTTCTCGAGAAATCCGTCTGTGCTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001360.2-929s21c1
Sequence:CCGGACATGATGGGCATCGAGTTTACTCGAGTAAACTCGATGCCCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001360.1-536s1c1
Sequence:CCGGCCCTGACTTCTGCCATAAGTTCTCGAGAACTTATGGCAGAAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001360.1-1034s1c1
Sequence:CCGGCGTGATTGACTTCTTCTGGAACTCGAGTTCCAGAAGAAGTCAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001360.1-818s1c1
Sequence:CCGGCTGCAAATTCACAGGCAATTTCTCGAGAAATTGCCTGTGAATTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001360.1-701s1c1
Sequence:CCGGGCCCACCATCATCTTCGACAACTCGAGTTGTCGAAGATGATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_001360.1-1136s1c1
Sequence:CCGGGCCTTATCTTTACACGCTGCACTCGAGTGCAGCGTGTAAAGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001360
VALIDATED
DHCR7 MISSION shRNA Lentiviral Transduction Particles
7-dehydrocholesterol reductase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001360.2-974s21c1
Sequence:GTACCGGACTTCAAGCTGTTCTTCAATGCTCGAGCATTGAAGAACAGCTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001360.2-530s21c1
Sequence:CCGGGGGCCAAGACTCCACCTATAACTCGAGTTATAGGTGGAGTCTTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001360.2-1913s21c1
Sequence:CCGGATTGCCAGCACAGACGGATTTCTCGAGAAATCCGTCTGTGCTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001360.2-929s21c1
Sequence:CCGGACATGATGGGCATCGAGTTTACTCGAGTAAACTCGATGCCCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001360.1-536s1c1
Sequence:CCGGCCCTGACTTCTGCCATAAGTTCTCGAGAACTTATGGCAGAAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001360.1-1034s1c1
Sequence:CCGGCGTGATTGACTTCTTCTGGAACTCGAGTTCCAGAAGAAGTCAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001360.1-818s1c1
Sequence:CCGGCTGCAAATTCACAGGCAATTTCTCGAGAAATTGCCTGTGAATTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001360.1-701s1c1
Sequence:CCGGGCCCACCATCATCTTCGACAACTCGAGTTGTCGAAGATGATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_001360.1-1136s1c1
Sequence:CCGGGCCTTATCTTTACACGCTGCACTCGAGTGCAGCGTGTAAAGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks