EMAIL THIS PAGE TO A FRIEND

DHDDS

dehydrodolichyl diphosphate synthase

320 Gene Product Result for
Synonyms: CIT CPT DS HDS RP59
Gene ID:
Human(79947) Summary: The protein encoded by this gene catalyzes cis-prenyl chain elongation to produce the polyprenyl backbone of dolichol, a glycosyl carrier lipid required for the biosynthesis of several classes of glycoproteins. Mutations in this gene are associated with retinitis pigmentosa type 59. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(67422) dehydrodolichyl diphosphate synthase
Rat(298541) dehydrodolichyl diphosphate synthase
Zebrafish(406468) dehydrodolichyl diphosphate synthase
cow(523264) dehydrodolichyl diphosphate synthase
Horse(100057242) dehydrodolichyl diphosphate synthase
domestic cat(101085905) dehydrodolichyl diphosphate synthase
dog(612157) dehydrodolichyl diphosphate synthase
chicken(419543) dehydrodolichyl diphosphate synthase
sheep(101110654) dehydrodolichyl diphosphate synthase
domestic guinea pig(100729457) dehydrodolichyl diphosphate synthase
naked mole-rat(101711794) dehydrodolichyl diphosphate synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024887 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024887 Rosetta Predictions human pricing
NM_205861 Rosetta Predictions human pricing
NM_001011978 Rosetta Predictions rat pricing
XM_575927 Rosetta Predictions rat pricing
NM_026144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063108 predicted 280
2 SASI_Hs01_00063110 predicted 1322
3 SASI_Hs01_00063111 predicted 1571
4 SASI_Hs01_00063113 predicted 1546
5 SASI_Hs01_00063114 predicted 532
6 SASI_Hs01_00063115 predicted 1390
7 SASI_Hs01_00063116 predicted 332
8 SASI_Hs02_00357479 predicted 555
9 SASI_Hs01_00063117 predicted 305
10 SASI_Hs02_00357480 predicted 200
11 SASI_Hs01_00063109 predicted 1453
12 SASI_Hs01_00063112 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069512 predicted 278
2 SASI_Hs01_00069514 predicted 1321
3 SASI_Hs01_00069515 predicted 1566
4 SASI_Hs01_00069517 predicted 1546
5 SASI_Hs01_00069518 predicted 532
6 SASI_Hs01_00069519 predicted 1382
7 SASI_Hs01_00069520 predicted 340
8 SASI_Hs02_00373502 predicted 559
9 SASI_Hs01_00069521 predicted 305
10 SASI_Hs02_00373503 predicted 205
11 SASI_Hs01_00069513 predicted 1452
12 SASI_Hs01_00069516 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200001 predicted 201
2 SASI_Rn01_00118166 predicted 417
3 SASI_Rn02_00200002 predicted 283
4 SASI_Rn01_00118167 predicted 685
5 SASI_Rn01_00118168 predicted 344
6 SASI_Rn01_00118169 predicted 758
7 SASI_Rn01_00118170 predicted 860
8 SASI_Rn02_00200003 predicted 196
9 SASI_Rn01_00118173 predicted 544
10 SASI_Rn01_00118175 predicted 723
11 SASI_Rn01_00118171 predicted 851
12 SASI_Rn01_00118172 predicted 324
13 SASI_Rn01_00118174 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142566 predicted 508
2 SASI_Rn01_00142567 predicted 780
3 SASI_Rn01_00142568 predicted 444
4 SASI_Rn01_00142569 predicted 856
5 SASI_Rn01_00142570 predicted 958
6 SASI_Rn01_00142571 predicted 952
7 SASI_Rn01_00142572 predicted 413
8 SASI_Rn01_00142573 predicted 639
9 SASI_Rn01_00142574 predicted 314
10 SASI_Rn01_00142575 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053367 predicted 224
2 SASI_Mm01_00053368 predicted 222
3 SASI_Mm01_00053369 predicted 709
4 SASI_Mm01_00053370 predicted 567
5 SASI_Mm01_00053371 predicted 304
6 SASI_Mm01_00053372 predicted 611
7 SASI_Mm01_00053373 predicted 366
8 SASI_Mm01_00053374 predicted 370
9 SASI_Mm01_00053375 predicted 564
10 SASI_Mm01_00053376 predicted 873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024887
VALIDATED
DHDDS MISSION shRNA Bacterial Glycerol Stock
dehydrodolichyl diphosphate synthase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024887.2-197s1c1
Sequence:CCGGCCGAAACACATTGCATTCATACTCGAGTATGAATGCAATGTGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024887.2-680s1c1
Sequence:CCGGCTGCTTGATAAGTGCCTCTATCTCGAGATAGAGGCACTTATCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024887.2-546s1c1
Sequence:CCGGCGAAGAACTACAACAAGTGTTCTCGAGAACACTTGTTGTAGTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024887.2-719s1c1
Sequence:CCGGCCTGACATCTTGATACGGACTCTCGAGAGTCCGTATCAAGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024887.2-1549s21c1
Sequence:CCGGACCTTGGATCTGCTAGTAAATCTCGAGATTTACTAGCAGATCCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024887.2-1008s21c1
Sequence:CCGGGAAGGACACGCTTGCACAAACCTCGAGGTTTGTGCAAGCGTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024887.2-164s21c1
Sequence:CCGGTTCTGTGCCAACATCATAAAGCTCGAGCTTTATGATGTTGGCACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024887.2-888s21c1
Sequence:CCGGAGAAGGCCCGAGACATGTATGCTCGAGCATACATGTCTCGGGCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024887.2-382s21c1
Sequence:CCGGGAGTGAGGTAGACGGGCTTATCTCGAGATAAGCCCGTCTACCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024887.2-1331s21c1
Sequence:CCGGGTCTCCCACGAGTACACTAAACTCGAGTTTAGTGTACTCGTGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024887
VALIDATED
DHDDS MISSION shRNA shRNA Plasmid DNA
dehydrodolichyl diphosphate synthase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024887.2-197s1c1
Sequence:CCGGCCGAAACACATTGCATTCATACTCGAGTATGAATGCAATGTGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024887.2-680s1c1
Sequence:CCGGCTGCTTGATAAGTGCCTCTATCTCGAGATAGAGGCACTTATCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024887.2-546s1c1
Sequence:CCGGCGAAGAACTACAACAAGTGTTCTCGAGAACACTTGTTGTAGTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024887.2-719s1c1
Sequence:CCGGCCTGACATCTTGATACGGACTCTCGAGAGTCCGTATCAAGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024887.2-1549s21c1
Sequence:CCGGACCTTGGATCTGCTAGTAAATCTCGAGATTTACTAGCAGATCCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024887.2-1008s21c1
Sequence:CCGGGAAGGACACGCTTGCACAAACCTCGAGGTTTGTGCAAGCGTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024887.2-164s21c1
Sequence:CCGGTTCTGTGCCAACATCATAAAGCTCGAGCTTTATGATGTTGGCACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024887.2-888s21c1
Sequence:CCGGAGAAGGCCCGAGACATGTATGCTCGAGCATACATGTCTCGGGCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024887.2-382s21c1
Sequence:CCGGGAGTGAGGTAGACGGGCTTATCTCGAGATAAGCCCGTCTACCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024887.2-1331s21c1
Sequence:CCGGGTCTCCCACGAGTACACTAAACTCGAGTTTAGTGTACTCGTGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024887
VALIDATED
DHDDS MISSION shRNA Lentiviral Transduction Particles
dehydrodolichyl diphosphate synthase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024887.2-197s1c1
Sequence:CCGGCCGAAACACATTGCATTCATACTCGAGTATGAATGCAATGTGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024887.2-680s1c1
Sequence:CCGGCTGCTTGATAAGTGCCTCTATCTCGAGATAGAGGCACTTATCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024887.2-546s1c1
Sequence:CCGGCGAAGAACTACAACAAGTGTTCTCGAGAACACTTGTTGTAGTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024887.2-719s1c1
Sequence:CCGGCCTGACATCTTGATACGGACTCTCGAGAGTCCGTATCAAGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024887.2-1549s21c1
Sequence:CCGGACCTTGGATCTGCTAGTAAATCTCGAGATTTACTAGCAGATCCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024887.2-1008s21c1
Sequence:CCGGGAAGGACACGCTTGCACAAACCTCGAGGTTTGTGCAAGCGTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024887.2-164s21c1
Sequence:CCGGTTCTGTGCCAACATCATAAAGCTCGAGCTTTATGATGTTGGCACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024887.2-888s21c1
Sequence:CCGGAGAAGGCCCGAGACATGTATGCTCGAGCATACATGTCTCGGGCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024887.2-382s21c1
Sequence:CCGGGAGTGAGGTAGACGGGCTTATCTCGAGATAAGCCCGTCTACCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024887.2-1331s21c1
Sequence:CCGGGTCTCCCACGAGTACACTAAACTCGAGTTTAGTGTACTCGTGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026144
VALIDATED
DHDDS MISSION shRNA Bacterial Glycerol Stock
dehydrodolichyl diphosphate synthase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026144.2-225s1c1
Sequence:CCGGCCCAAACATATCGCGTTCATACTCGAGTATGAACGCGATATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026144.2-707s1c1
Sequence:CCGGTCTGCTCGATAAGTGCCTCTACTCGAGTAGAGGCACTTATCGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026144.2-708s1c1
Sequence:CCGGCTGCTCGATAAGTGCCTCTATCTCGAGATAGAGGCACTTATCGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026144.2-377s1c1
Sequence:CCGGCGCATTCAGCATTGAGAACTTCTCGAGAAGTTCTCAATGCTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026144.4-568s21c1
Sequence:CCGGGGCTACTAAGAACTACAATAACTCGAGTTATTGTAGTTCTTAGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026144.2-2665s1c2
Sequence:CCGGCCCTACAATTAAGGCGGGAATCTCGAGATTCCCGCCTTAATTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026144.4-224s21c1
Sequence:CCGGCCCAAACATATCGCGTTCATACTCGAGTATGAACGCGATATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026144.4-376s21c1
Sequence:CCGGCGCATTCAGCATTGAGAACTTCTCGAGAAGTTCTCAATGCTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026144.4-1419s21c1
Sequence:CCGGACCCTAATTCATTAGCTATATCTCGAGATATAGCTAATGAATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026144.4-707s21c1
Sequence:CCGGCTGCTCGATAAGTGCCTCTATCTCGAGATAGAGGCACTTATCGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026144
VALIDATED
DHDDS MISSION shRNA shRNA Plasmid DNA
dehydrodolichyl diphosphate synthase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026144.2-225s1c1
Sequence:CCGGCCCAAACATATCGCGTTCATACTCGAGTATGAACGCGATATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026144.2-707s1c1
Sequence:CCGGTCTGCTCGATAAGTGCCTCTACTCGAGTAGAGGCACTTATCGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026144.2-708s1c1
Sequence:CCGGCTGCTCGATAAGTGCCTCTATCTCGAGATAGAGGCACTTATCGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026144.2-377s1c1
Sequence:CCGGCGCATTCAGCATTGAGAACTTCTCGAGAAGTTCTCAATGCTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026144.4-568s21c1
Sequence:CCGGGGCTACTAAGAACTACAATAACTCGAGTTATTGTAGTTCTTAGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026144.2-2665s1c2
Sequence:CCGGCCCTACAATTAAGGCGGGAATCTCGAGATTCCCGCCTTAATTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026144.4-224s21c1
Sequence:CCGGCCCAAACATATCGCGTTCATACTCGAGTATGAACGCGATATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026144.4-376s21c1
Sequence:CCGGCGCATTCAGCATTGAGAACTTCTCGAGAAGTTCTCAATGCTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026144.4-1419s21c1
Sequence:CCGGACCCTAATTCATTAGCTATATCTCGAGATATAGCTAATGAATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026144.4-707s21c1
Sequence:CCGGCTGCTCGATAAGTGCCTCTATCTCGAGATAGAGGCACTTATCGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026144
VALIDATED
DHDDS MISSION shRNA Lentiviral Transduction Particles
dehydrodolichyl diphosphate synthase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026144.2-225s1c1
Sequence:CCGGCCCAAACATATCGCGTTCATACTCGAGTATGAACGCGATATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026144.2-707s1c1
Sequence:CCGGTCTGCTCGATAAGTGCCTCTACTCGAGTAGAGGCACTTATCGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026144.2-708s1c1
Sequence:CCGGCTGCTCGATAAGTGCCTCTATCTCGAGATAGAGGCACTTATCGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026144.2-377s1c1
Sequence:CCGGCGCATTCAGCATTGAGAACTTCTCGAGAAGTTCTCAATGCTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026144.4-568s21c1
Sequence:CCGGGGCTACTAAGAACTACAATAACTCGAGTTATTGTAGTTCTTAGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026144.2-2665s1c2
Sequence:CCGGCCCTACAATTAAGGCGGGAATCTCGAGATTCCCGCCTTAATTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026144.4-224s21c1
Sequence:CCGGCCCAAACATATCGCGTTCATACTCGAGTATGAACGCGATATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026144.4-376s21c1
Sequence:CCGGCGCATTCAGCATTGAGAACTTCTCGAGAAGTTCTCAATGCTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026144.4-1419s21c1
Sequence:CCGGACCCTAATTCATTAGCTATATCTCGAGATATAGCTAATGAATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026144.4-707s21c1
Sequence:CCGGCTGCTCGATAAGTGCCTCTATCTCGAGATAGAGGCACTTATCGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks