EMAIL THIS PAGE TO A FRIEND

DHDH

dihydrodiol dehydrogenase (dimeric)

48 Gene Product Result for
Synonyms: 2DD HUM2DD
UniProtKB ID: Q9UQ10
Gene ID:
Human(27294) Summary: This gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of transdihydrodiols of aromatic hydrocarbons to corresponding catechols. This enzyme is a dimeric dihydrodiol dehydrogenase, and it differs from monomeric dihydrodiol dehydrogenases in its high substrate specificity for trans-dihydrodiols of aromatic hydrocarbons in the oxidative direction. [provided by RefSeq, Jul 2008]
Mouse(71755) dihydrodiol dehydrogenase (dimeric)
Rat(691002) dihydrodiol dehydrogenase (dimeric)
naked mole-rat(101713222) dihydrodiol dehydrogenase (dimeric)
domestic guinea pig(100731362) dihydrodiol dehydrogenase (dimeric)
sheep(101103175) dihydrodiol dehydrogenase (dimeric)
Domestic Rabbit(100008610) dihydrodiol dehydrogenase (dimeric)
cow(617564) dihydrodiol dehydrogenase (dimeric)
domestic cat(101101272) dihydrodiol dehydrogenase (dimeric)
dog(403786) dihydrodiol dehydrogenase (dimeric)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014475 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119451 MISSION® esiRNA esiRNA human DHDH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014475 Rosetta Predictions human pricing
XM_001076463 Rosetta Predictions rat pricing
NM_027903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345709 predicted 854
2 SASI_Hs01_00218883 predicted 499
3 SASI_Hs02_00345710 predicted 633
4 SASI_Hs01_00218885 predicted 761
5 SASI_Hs01_00218886 predicted 569
6 SASI_Hs01_00218887 predicted 665
7 SASI_Hs01_00218888 predicted 405
8 SASI_Hs01_00218889 predicted 205
9 SASI_Hs01_00218890 predicted 562
10 SASI_Hs01_00218891 predicted 619
11 SASI_Hs01_00218882 predicted 599
12 SASI_Hs01_00218884 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353332 predicted 313
2 SASI_Rn02_00353333 predicted 311
3 SASI_Rn02_00353334 predicted 28
4 SASI_Rn02_00353335 predicted 228
5 SASI_Rn02_00353336 predicted 202
6 SASI_Rn02_00353337 predicted 348
7 SASI_Rn02_00353338 predicted 138
8 SASI_Rn02_00353339 predicted 55
9 SASI_Rn02_00353340 predicted 68
10 SASI_Rn02_00353341 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108842 predicted 623
2 SASI_Mm02_00332878 predicted 573
3 SASI_Mm01_00108843 predicted 489
4 SASI_Mm01_00108844 predicted 224
5 SASI_Mm01_00108845 predicted 671
6 SASI_Mm01_00108846 predicted 467
7 SASI_Mm01_00108847 predicted 789
8 SASI_Mm01_00108849 predicted 738
9 SASI_Mm01_00108850 predicted 581
10 SASI_Mm01_00108851 predicted 390
11 SASI_Mm01_00108848 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014475
DHDH MISSION shRNA Bacterial Glycerol Stock
dihydrodiol dehydrogenase (dimeric)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014475.3-75s21c1
Sequence:CCGGTCATCTCCAGCGACTTCACAGCTCGAGCTGTGAAGTCGCTGGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014475.3-588s21c1
Sequence:CCGGAGTTCACCTCCATGGTCTTTGCTCGAGCAAAGACCATGGAGGTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-183s1c1
Sequence:CCGGGTTTGCACAGAAACACGACATCTCGAGATGTCGTGTTTCTGTGCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-159s1c1
Sequence:CCGGCCGCGATCTGAGCCGTGCGAACTCGAGTTCGCACGGCTCAGATCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-940s1c1
Sequence:CCGGCGCAAGGGTATGAAGGAAAGTCTCGAGACTTTCCTTCATACCCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-502s1c1
Sequence:CCGGCGGGCAGAATTTGGGAAGAATCTCGAGATTCTTCCCAAATTCTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-867s1c1
Sequence:CCGGAGTCCCAAAGGACTGCAATTTCTCGAGAAATTGCAGTCCTTTGGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014475
DHDH MISSION shRNA shRNA Plasmid DNA
dihydrodiol dehydrogenase (dimeric)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014475.3-75s21c1
Sequence:CCGGTCATCTCCAGCGACTTCACAGCTCGAGCTGTGAAGTCGCTGGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014475.3-588s21c1
Sequence:CCGGAGTTCACCTCCATGGTCTTTGCTCGAGCAAAGACCATGGAGGTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-183s1c1
Sequence:CCGGGTTTGCACAGAAACACGACATCTCGAGATGTCGTGTTTCTGTGCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-159s1c1
Sequence:CCGGCCGCGATCTGAGCCGTGCGAACTCGAGTTCGCACGGCTCAGATCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-940s1c1
Sequence:CCGGCGCAAGGGTATGAAGGAAAGTCTCGAGACTTTCCTTCATACCCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-502s1c1
Sequence:CCGGCGGGCAGAATTTGGGAAGAATCTCGAGATTCTTCCCAAATTCTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-867s1c1
Sequence:CCGGAGTCCCAAAGGACTGCAATTTCTCGAGAAATTGCAGTCCTTTGGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014475
DHDH MISSION shRNA Lentiviral Transduction Particles
dihydrodiol dehydrogenase (dimeric)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014475.3-75s21c1
Sequence:CCGGTCATCTCCAGCGACTTCACAGCTCGAGCTGTGAAGTCGCTGGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014475.3-588s21c1
Sequence:CCGGAGTTCACCTCCATGGTCTTTGCTCGAGCAAAGACCATGGAGGTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-183s1c1
Sequence:CCGGGTTTGCACAGAAACACGACATCTCGAGATGTCGTGTTTCTGTGCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-159s1c1
Sequence:CCGGCCGCGATCTGAGCCGTGCGAACTCGAGTTCGCACGGCTCAGATCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-940s1c1
Sequence:CCGGCGCAAGGGTATGAAGGAAAGTCTCGAGACTTTCCTTCATACCCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-502s1c1
Sequence:CCGGCGGGCAGAATTTGGGAAGAATCTCGAGATTCTTCCCAAATTCTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014475.2-867s1c1
Sequence:CCGGAGTCCCAAAGGACTGCAATTTCTCGAGAAATTGCAGTCCTTTGGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027903
DHDH MISSION shRNA Bacterial Glycerol Stock
dihydrodiol dehydrogenase (dimeric)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027903.1-2460s1c1
Sequence:CCGGGCCAGAAGATAAGAACACATTCTCGAGAATGTGTTCTTATCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027903.1-160s1c1
Sequence:CCGGCGAGGAGTTCGCACAGAAATTCTCGAGAATTTCTGTGCGAACTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027903.1-847s1c1
Sequence:CCGGCCTTGGGAAGGACTACAATTTCTCGAGAAATTGTAGTCCTTCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027903.1-1391s1c1
Sequence:CCGGGCAAACTCTTTGAAGAAGTATCTCGAGATACTTCTTCAAAGAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027903
DHDH MISSION shRNA shRNA Plasmid DNA
dihydrodiol dehydrogenase (dimeric)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027903.1-2460s1c1
Sequence:CCGGGCCAGAAGATAAGAACACATTCTCGAGAATGTGTTCTTATCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027903.1-160s1c1
Sequence:CCGGCGAGGAGTTCGCACAGAAATTCTCGAGAATTTCTGTGCGAACTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027903.1-847s1c1
Sequence:CCGGCCTTGGGAAGGACTACAATTTCTCGAGAAATTGTAGTCCTTCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027903.1-1391s1c1
Sequence:CCGGGCAAACTCTTTGAAGAAGTATCTCGAGATACTTCTTCAAAGAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027903
DHDH MISSION shRNA Lentiviral Transduction Particles
dihydrodiol dehydrogenase (dimeric)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027903.1-2460s1c1
Sequence:CCGGGCCAGAAGATAAGAACACATTCTCGAGAATGTGTTCTTATCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027903.1-160s1c1
Sequence:CCGGCGAGGAGTTCGCACAGAAATTCTCGAGAATTTCTGTGCGAACTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027903.1-847s1c1
Sequence:CCGGCCTTGGGAAGGACTACAATTTCTCGAGAAATTGTAGTCCTTCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027903.1-1391s1c1
Sequence:CCGGGCAAACTCTTTGAAGAAGTATCTCGAGATACTTCTTCAAAGAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks