EMAIL THIS PAGE TO A FRIEND

DHFR

dihydrofolate reductase

55 Gene Product Result for
Synonyms: DHFRP1 DYR
UniProtKB ID: P00374, Q14130, Q6IRW8
Gene ID:
Human(1719) Summary: Dihydrofolate reductase converts dihydrofolate into tetrahydrofolate, a methyl group shuttle required for the de novo synthesis of purines, thymidylic acid, and certain amino acids. While the functional dihydrofolate reductase gene has been mapped to chromosome 5, multiple intronless processed pseudogenes or dihydrofolate reductase-like genes have been identified on separate chromosomes. Dihydrofolate reductase deficiency has been linked to megaloblastic anemia. [provided by RefSeq, Jul 2008]
Mouse(13361) dihydrofolate reductase
Rat(24312) dihydrofolate reductase
Zebrafish(81882) dihydrofolate reductase
cow(508809) dihydrofolate reductase
domestic cat(101087964) dihydrofolate reductase
dog(609048) dihydrofolate reductase
chicken(427317) dihydrofolate reductase
fruit fly(42003) Dihydrofolate reductase
sheep(101121421) dihydrofolate reductase
Domestic Rabbit(100359209) dihydrofolate reductase
domestic guinea pig(100729225) dihydrofolate reductase
naked mole-rat(101701790) dihydrofolate reductase
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000791 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU070791 MISSION® esiRNA esiRNA targeting mouse Dhfr (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000791 Rosetta Predictions human pricing
NM_130400 Rosetta Predictions rat pricing
NM_010049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050570 predicted 1144
2 SASI_Hs01_00050571 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078589 predicted 405
2 SASI_Rn01_00078590 predicted 274
3 SASI_Rn01_00078591 predicted 387
4 SASI_Rn01_00078592 predicted 521
5 SASI_Rn01_00078593 predicted 262
6 SASI_Rn01_00078594 predicted 428
7 SASI_Rn01_00078595 predicted 268
8 SASI_Rn02_00267377 predicted 279
9 SASI_Rn02_00267378 predicted 475
10 SASI_Rn02_00267379 predicted 197
11 SASI_Rn01_00078596 predicted 724
12 SASI_Rn01_00078597 predicted 729
13 SASI_Rn01_00078598 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026215 predicted 864
2 SASI_Mm01_00026216 predicted 762
3 SASI_Mm01_00026217 predicted 672
4 SASI_Mm01_00026218 predicted 752
5 SASI_Mm01_00026219 predicted 888
6 SASI_Mm01_00026220 predicted 882
7 SASI_Mm01_00026221 predicted 786
8 SASI_Mm01_00026223 predicted 792
9 SASI_Mm01_00026224 predicted 604
10 SASI_Mm02_00317691 predicted 621
11 SASI_Mm01_00026222 predicted 1048
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010049
VALIDATED
DHFR MISSION shRNA Bacterial Glycerol Stock
dihydrofolate reductase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010049.2-258s1c1
Sequence:CCGGCTGGTGATTATGGGTAGGAAACTCGAGTTTCCTACCCATAATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010049.2-518s1c1
Sequence:CCGGGACAAGGATCATGCAGGAATTCTCGAGAATTCCTGCATGATCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010049.2-211s1c1
Sequence:CCGGACTTCCAAAGAATGACCACAACTCGAGTTGTGGTCATTCTTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010049.2-406s1c1
Sequence:CCGGGACTTATTGAACAACCGGAATCTCGAGATTCCGGTTGTTCAATAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010049.2-647s1c1
Sequence:CCGGGTTTGAAGTCTACGAGAAGAACTCGAGTTCTTCTCGTAGACTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010049.3-772s21c1
Sequence:CCGGGACTTATTGAACAACCGGAATCTCGAGATTCCGGTTGTTCAATAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010049.3-884s21c1
Sequence:CCGGGACAAGGATCATGCAGGAATTCTCGAGAATTCCTGCATGATCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010049.3-624s21c1
Sequence:CCGGCTGGTGATTATGGGTAGGAAACTCGAGTTTCCTACCCATAATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010049.3-1013s21c1
Sequence:CCGGGTTTGAAGTCTACGAGAAGAACTCGAGTTCTTCTCGTAGACTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010049
VALIDATED
DHFR MISSION shRNA shRNA Plasmid DNA
dihydrofolate reductase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010049.2-258s1c1
Sequence:CCGGCTGGTGATTATGGGTAGGAAACTCGAGTTTCCTACCCATAATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010049.2-518s1c1
Sequence:CCGGGACAAGGATCATGCAGGAATTCTCGAGAATTCCTGCATGATCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010049.2-211s1c1
Sequence:CCGGACTTCCAAAGAATGACCACAACTCGAGTTGTGGTCATTCTTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010049.2-406s1c1
Sequence:CCGGGACTTATTGAACAACCGGAATCTCGAGATTCCGGTTGTTCAATAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010049.2-647s1c1
Sequence:CCGGGTTTGAAGTCTACGAGAAGAACTCGAGTTCTTCTCGTAGACTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010049.3-772s21c1
Sequence:CCGGGACTTATTGAACAACCGGAATCTCGAGATTCCGGTTGTTCAATAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010049.3-884s21c1
Sequence:CCGGGACAAGGATCATGCAGGAATTCTCGAGAATTCCTGCATGATCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010049.3-624s21c1
Sequence:CCGGCTGGTGATTATGGGTAGGAAACTCGAGTTTCCTACCCATAATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010049.3-1013s21c1
Sequence:CCGGGTTTGAAGTCTACGAGAAGAACTCGAGTTCTTCTCGTAGACTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010049
VALIDATED
DHFR MISSION shRNA Lentiviral Transduction Particles
dihydrofolate reductase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010049.2-258s1c1
Sequence:CCGGCTGGTGATTATGGGTAGGAAACTCGAGTTTCCTACCCATAATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010049.2-518s1c1
Sequence:CCGGGACAAGGATCATGCAGGAATTCTCGAGAATTCCTGCATGATCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010049.2-211s1c1
Sequence:CCGGACTTCCAAAGAATGACCACAACTCGAGTTGTGGTCATTCTTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010049.2-406s1c1
Sequence:CCGGGACTTATTGAACAACCGGAATCTCGAGATTCCGGTTGTTCAATAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010049.2-647s1c1
Sequence:CCGGGTTTGAAGTCTACGAGAAGAACTCGAGTTCTTCTCGTAGACTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010049.3-772s21c1
Sequence:CCGGGACTTATTGAACAACCGGAATCTCGAGATTCCGGTTGTTCAATAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010049.3-884s21c1
Sequence:CCGGGACAAGGATCATGCAGGAATTCTCGAGAATTCCTGCATGATCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010049.3-624s21c1
Sequence:CCGGCTGGTGATTATGGGTAGGAAACTCGAGTTTCCTACCCATAATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010049.3-1013s21c1
Sequence:CCGGGTTTGAAGTCTACGAGAAGAACTCGAGTTCTTCTCGTAGACTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000791
VALIDATED
DHFR MISSION shRNA Bacterial Glycerol Stock
dihydrofolate reductase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000791.2-747s1c1
Sequence:CCGGCTTTCCAGAAGTCTAGATGATCTCGAGATCATCTAGACTTCTGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000791.2-799s1c1
Sequence:CCGGCAAATAAAGTAGACATGGTCTCTCGAGAGACCATGTCTACTTTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000791.2-864s1c1
Sequence:CCGGCCAGGCCATCTTAAACTATTTCTCGAGAAATAGTTTAAGATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000791.2-663s1c1
Sequence:CCGGCCTGAGAAGAATCGACCTTTACTCGAGTAAAGGTCGATTCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000791.2-927s1c1
Sequence:CCGGCCAGAAATTGATTTGGAGAAACTCGAGTTTCTCCAAATCAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-531s21c1
Sequence:CCGGGAACATGGGCATCGGCAAGAACTCGAGTTCTTGCCGATGCCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-607s21c1
Sequence:CCGGACCACAACCTCTTCAGTAGAACTCGAGTTCTACTGAAGAGGTTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-629s21c1
Sequence:CCGGGTAAACAGAATCTGGTGATTACTCGAGTAATCACCAGATTCTGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000791.3-1218s21c1
Sequence:CCGGGACATTCTTGCTATAACTAAGCTCGAGCTTAGTTATAGCAAGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-738s21c1
Sequence:CCGGACCTCCACAAGGAGCTCATTTCTCGAGAAATGAGCTCCTTGTGGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-1011s21c1
Sequence:CCGGGAAAGGCATTAAGTACAAATTCTCGAGAATTTGTACTTAATGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-837s21c1
Sequence:CCGGAGTTGGTGGCAGTTCTGTTTACTCGAGTAAACAGAACTGCCACCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000791
VALIDATED
DHFR MISSION shRNA shRNA Plasmid DNA
dihydrofolate reductase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000791.2-747s1c1
Sequence:CCGGCTTTCCAGAAGTCTAGATGATCTCGAGATCATCTAGACTTCTGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000791.2-799s1c1
Sequence:CCGGCAAATAAAGTAGACATGGTCTCTCGAGAGACCATGTCTACTTTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000791.2-864s1c1
Sequence:CCGGCCAGGCCATCTTAAACTATTTCTCGAGAAATAGTTTAAGATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000791.2-663s1c1
Sequence:CCGGCCTGAGAAGAATCGACCTTTACTCGAGTAAAGGTCGATTCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000791.2-927s1c1
Sequence:CCGGCCAGAAATTGATTTGGAGAAACTCGAGTTTCTCCAAATCAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-531s21c1
Sequence:CCGGGAACATGGGCATCGGCAAGAACTCGAGTTCTTGCCGATGCCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-607s21c1
Sequence:CCGGACCACAACCTCTTCAGTAGAACTCGAGTTCTACTGAAGAGGTTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-629s21c1
Sequence:CCGGGTAAACAGAATCTGGTGATTACTCGAGTAATCACCAGATTCTGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000791.3-1218s21c1
Sequence:CCGGGACATTCTTGCTATAACTAAGCTCGAGCTTAGTTATAGCAAGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-738s21c1
Sequence:CCGGACCTCCACAAGGAGCTCATTTCTCGAGAAATGAGCTCCTTGTGGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-1011s21c1
Sequence:CCGGGAAAGGCATTAAGTACAAATTCTCGAGAATTTGTACTTAATGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-837s21c1
Sequence:CCGGAGTTGGTGGCAGTTCTGTTTACTCGAGTAAACAGAACTGCCACCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000791
VALIDATED
DHFR MISSION shRNA Lentiviral Transduction Particles
dihydrofolate reductase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000791.2-747s1c1
Sequence:CCGGCTTTCCAGAAGTCTAGATGATCTCGAGATCATCTAGACTTCTGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000791.2-799s1c1
Sequence:CCGGCAAATAAAGTAGACATGGTCTCTCGAGAGACCATGTCTACTTTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000791.2-864s1c1
Sequence:CCGGCCAGGCCATCTTAAACTATTTCTCGAGAAATAGTTTAAGATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000791.2-663s1c1
Sequence:CCGGCCTGAGAAGAATCGACCTTTACTCGAGTAAAGGTCGATTCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000791.2-927s1c1
Sequence:CCGGCCAGAAATTGATTTGGAGAAACTCGAGTTTCTCCAAATCAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-531s21c1
Sequence:CCGGGAACATGGGCATCGGCAAGAACTCGAGTTCTTGCCGATGCCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-607s21c1
Sequence:CCGGACCACAACCTCTTCAGTAGAACTCGAGTTCTACTGAAGAGGTTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-629s21c1
Sequence:CCGGGTAAACAGAATCTGGTGATTACTCGAGTAATCACCAGATTCTGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000791.3-1218s21c1
Sequence:CCGGGACATTCTTGCTATAACTAAGCTCGAGCTTAGTTATAGCAAGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-738s21c1
Sequence:CCGGACCTCCACAAGGAGCTCATTTCTCGAGAAATGAGCTCCTTGTGGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-1011s21c1
Sequence:CCGGGAAAGGCATTAAGTACAAATTCTCGAGAATTTGTACTTAATGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000791.3-837s21c1
Sequence:CCGGAGTTGGTGGCAGTTCTGTTTACTCGAGTAAACAGAACTGCCACCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks